ID: 1141568618

View in Genome Browser
Species Human (GRCh38)
Location 16:84920639-84920661
Sequence CAGGGACCAGATGACATGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 5, 2: 9, 3: 9, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141568618_1141568624 11 Left 1141568618 16:84920639-84920661 CCGACCATGTCATCTGGTCCCTG 0: 1
1: 5
2: 9
3: 9
4: 194
Right 1141568624 16:84920673-84920695 CTTCATGAACTCCTGCTGCCTGG 0: 3
1: 6
2: 3
3: 17
4: 226
1141568618_1141568625 12 Left 1141568618 16:84920639-84920661 CCGACCATGTCATCTGGTCCCTG 0: 1
1: 5
2: 9
3: 9
4: 194
Right 1141568625 16:84920674-84920696 TTCATGAACTCCTGCTGCCTGGG 0: 3
1: 6
2: 4
3: 67
4: 1173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141568618 Original CRISPR CAGGGACCAGATGACATGGT CGG (reversed) Intronic
900041505 1:469767-469789 CTGGGACCAGCTTACATGATAGG - Intergenic
901130889 1:6962271-6962293 CAAGGACCAGCTGACCTGGGGGG - Intronic
901756972 1:11447250-11447272 CAGGGACCTGAAGCCATGCTGGG - Intergenic
901940834 1:12660460-12660482 CAGGGACTACCTGACATGCTTGG + Intronic
903366894 1:22810788-22810810 CAGGGACCAGGTGACATTTCAGG - Intronic
903367058 1:22811624-22811646 CAGGGACCAGGTGACATTTCAGG - Intronic
903685066 1:25125269-25125291 CAGGGACCAGACAACATGGTTGG + Intergenic
904064142 1:27735588-27735610 CAGGGAAGAGATGTCCTGGTTGG - Intronic
904453901 1:30635540-30635562 CATGGATCACAGGACATGGTGGG - Intergenic
904962697 1:34347237-34347259 CATGGACCAGACTCCATGGTAGG - Intergenic
906037093 1:42757661-42757683 CAGGGGCCAGATGTCAGTGTTGG - Intronic
906713144 1:47947579-47947601 CCAAGACCAGAAGACATGGTTGG + Intronic
907579100 1:55555900-55555922 CAGGGACAAGATAACATTTTGGG - Intergenic
908569847 1:65397827-65397849 AAGGTACTAGATGACTTGGTTGG + Intronic
912657868 1:111503882-111503904 CAGGGACCAGAGGACAGTGCAGG + Intronic
914862917 1:151401012-151401034 CAGTGACAAGATGACATGACTGG + Intronic
921156698 1:212444658-212444680 CTGAGTCGAGATGACATGGTAGG - Intronic
923921478 1:238569258-238569280 CAGGTAACAGATAACATGCTAGG - Intergenic
924568544 1:245218127-245218149 CAGAGGCCAGAGGCCATGGTGGG + Intronic
1065910064 10:30295205-30295227 CAAGGACCACATGACATCCTGGG + Intergenic
1067152449 10:43748140-43748162 CGTGGTCCAGCTGACATGGTGGG + Intergenic
1067897288 10:50197177-50197199 CAGTGACCAGAGTACAAGGTTGG + Intronic
1067951684 10:50744848-50744870 CAGTGACCAGAGTACAAGGTTGG - Intronic
1070953291 10:80447801-80447823 CTGGGACCTGATGACGTTGTGGG + Intergenic
1073854097 10:107655284-107655306 AGGGGACCAGATGACAAGGAAGG + Intergenic
1076242791 10:128922388-128922410 CAGAGAGCAGATGACCTGCTGGG - Intergenic
1076480013 10:130778811-130778833 CAGAGATCAGGTGACATGGTAGG - Intergenic
1076999209 11:314271-314293 CAGGGACCAGACGACATGGTCGG - Exonic
1077000656 11:320628-320650 CAGGGACCAGACGACATGGTCGG + Exonic
1077082044 11:728572-728594 CAGGGTCCATCTGACAGGGTGGG - Intergenic
1077306269 11:1869967-1869989 CAGGGAGCTGATGACGTGGCTGG - Intronic
1077498141 11:2896634-2896656 AAGGGACCAGAGGAGATGGGTGG - Intronic
1081365080 11:42225113-42225135 AAGAGAACAGATGACATTGTAGG + Intergenic
1081706297 11:45183574-45183596 CAGGGAGCAGACGATCTGGTAGG + Intronic
1082106640 11:48228602-48228624 CAGCTAACAGATGACAGGGTAGG - Intergenic
1084462479 11:69303622-69303644 CAGGGACCAGACAACATGGTCGG + Intronic
1084505593 11:69564920-69564942 CATGTACAAGATCACATGGTGGG + Intergenic
1085255637 11:75171166-75171188 CAGGGACCAGAGGACTCAGTTGG - Intronic
1085324721 11:75597779-75597801 CAGGGGCCAGATGAAAGGCTGGG + Intronic
1085547760 11:77336149-77336171 CAGGGACCAGATGTCAACCTTGG + Exonic
1086535674 11:87842209-87842231 AAGGGAGAAGATGACATGGAAGG + Intergenic
1090848543 11:130550347-130550369 CAGGGCCCACATACCATGGTAGG + Intergenic
1092260159 12:6949109-6949131 CAGGGACCAGAAGACTCAGTAGG - Intronic
1092956280 12:13553231-13553253 CAGGGACCAGAGGATAAGGGAGG + Exonic
1093755432 12:22846635-22846657 CAGGGACAAGATGGCAAGGATGG - Intergenic
1094583352 12:31754883-31754905 CAGGGACCAGACGACATGGTGGG - Intergenic
1095671867 12:44870976-44870998 CAGGAACCAGGTTACATGGTAGG - Intronic
1095880967 12:47135716-47135738 TAGGGACCAGACGACATGGTCGG + Intronic
1097177283 12:57150671-57150693 CAGGGAGGGGAGGACATGGTGGG + Intronic
1097798526 12:63888479-63888501 GATGCACCAGATCACATGGTTGG + Intronic
1097867008 12:64567352-64567374 CAGGAACCAGAGGAGATGATGGG - Intergenic
1100398155 12:94202829-94202851 CAGGGGCCAGATCACAGTGTTGG + Intronic
1100564830 12:95785637-95785659 CAGGGGCCTGATGAAAAGGTTGG - Intronic
1100623789 12:96308105-96308127 CAGGGGCCAGATGCTATGGGCGG + Intronic
1102275889 12:111581541-111581563 CAGGGACCAGACGACATGGTCGG - Intronic
1104475958 12:129070483-129070505 CTGGGTCCAGAAGACATCGTGGG + Intergenic
1104948862 12:132429707-132429729 CAGCCACCAGATGACAGCGTAGG + Intergenic
1106834068 13:33614948-33614970 CAGGGTCCAGTTGACATGGTAGG + Intergenic
1111179869 13:84650488-84650510 CTGGGAGCAGATGAAAGGGTTGG - Intergenic
1113115978 13:106875293-106875315 CATGAAACAGATGATATGGTTGG + Intergenic
1116567001 14:46460211-46460233 CTGGGACAAGATGACATTATTGG + Intergenic
1116877851 14:50131797-50131819 AAGGGATCAGATGATATGGAAGG + Intronic
1117675294 14:58149632-58149654 CAGGGATGAGATGATATGCTAGG - Intronic
1117994982 14:61470019-61470041 CAGGGAGCAGCTGCCATGGAGGG - Intronic
1118339038 14:64879660-64879682 CAGGGCCCAGAGGACCGGGTGGG - Intronic
1118723581 14:68610637-68610659 GAGGGACCAGAAGACTGGGTAGG - Intronic
1119879462 14:78088909-78088931 GAGGGGCCAGATAACATTGTTGG + Intergenic
1120696772 14:87653716-87653738 CAGGGACAACATGACAGGCTGGG + Intergenic
1121220390 14:92280551-92280573 TAGGGACCAGAAAACAGGGTAGG - Intergenic
1121718526 14:96093161-96093183 AAGAGACCACATGACATGCTGGG - Exonic
1121951810 14:98177536-98177558 CAGGGACCTGAAGACATGAGTGG + Intergenic
1125922723 15:43535126-43535148 CAGGGACCTTCTGACATGGCTGG + Exonic
1125922733 15:43535189-43535211 CAGGGACCTCCTGACATGGCTGG + Exonic
1126355048 15:47786545-47786567 CAGGGATCACTTGACATGATGGG - Intergenic
1127761973 15:62148372-62148394 CAGTGACCAGAGGCCATGGCAGG - Intergenic
1128200773 15:65805157-65805179 CAGGCCCCAGATGACTTGCTTGG + Intronic
1128312023 15:66636760-66636782 CAGGGCAGAAATGACATGGTGGG + Intronic
1129227409 15:74178160-74178182 CAAAAACCAAATGACATGGTAGG + Intergenic
1129920122 15:79312421-79312443 CAGTGACCAGATGACATCTGAGG - Intronic
1131179316 15:90229213-90229235 CAGGGACCAGAGGGCTAGGTTGG + Exonic
1132841943 16:1982364-1982386 GAGGGCCCAGCTGACCTGGTGGG + Exonic
1135191765 16:20360275-20360297 CACTGACCAGATGTCTTGGTGGG - Intronic
1136041617 16:27583939-27583961 TAGAGGCCAGATGGCATGGTGGG + Intronic
1136282367 16:29221228-29221250 CAGGGTCCAGCTCACCTGGTGGG + Intergenic
1138202811 16:55102672-55102694 CAGGGACCAAATGAAATGCATGG - Intergenic
1138272030 16:55702284-55702306 CGAGGACTTGATGACATGGTGGG - Intronic
1139613983 16:68078063-68078085 GAGGGACCAGGTGACTTGGCTGG - Intronic
1139662584 16:68431208-68431230 CAGGGAAGTGATGACATGCTTGG + Intronic
1141178804 16:81738571-81738593 TAGGGGCCAGATCACTTGGTGGG + Intergenic
1141568618 16:84920639-84920661 CAGGGACCAGATGACATGGTCGG - Intronic
1141704517 16:85657373-85657395 CAGAGAGAAGATGCCATGGTTGG - Exonic
1142086740 16:88187146-88187168 CAGGGTCCAGCTCACCTGGTGGG + Intergenic
1143997266 17:11017600-11017622 CAGTGGCCAGATGAAATGCTGGG + Intergenic
1144705857 17:17367416-17367438 CACAGAGCAGATGACATGCTGGG + Intergenic
1149414364 17:56443456-56443478 GATGGATCAGATGCCATGGTGGG + Intronic
1150582844 17:66491103-66491125 CACTGAGCAAATGACATGGTGGG - Intronic
1151369669 17:73639879-73639901 CAGAGACCAGATGGCCTTGTGGG + Intronic
1151535920 17:74738691-74738713 CAGGGAACAGATGAAGGGGTGGG - Intronic
1152041431 17:77906340-77906362 CAGGGACCAGAGGCCACAGTCGG - Intergenic
1152305834 17:79519696-79519718 AAGGGTCAAGCTGACATGGTGGG - Intergenic
1152796567 17:82310527-82310549 CAGGGACCAGAGGCCATGCAGGG - Intergenic
1154152100 18:11914407-11914429 CAGGGTCCAGATGTCAGGGATGG - Intergenic
1154333815 18:13450593-13450615 CAGGGGCTAGGTGACATGGGAGG + Intronic
1160235009 18:77078830-77078852 CAGGGACCAGAGCACAGGATTGG - Intronic
1162839458 19:13345288-13345310 CAGGGTGCAGATGGCATGGGTGG + Intronic
1163484299 19:17577017-17577039 CAGGGTTCAAATGACATGGGAGG + Intronic
1165963503 19:39554993-39555015 CAGGGACCACGTGACATAGAGGG + Intergenic
926173944 2:10572317-10572339 CAGGCTCCAGGGGACATGGTGGG + Intronic
929490536 2:42392276-42392298 AAGGGACCAGGTGACCTGGCAGG - Intronic
931268681 2:60683059-60683081 CAGGGACCAGACGACATGGCTGG + Intergenic
932227344 2:70053007-70053029 CATGGAGGAGAGGACATGGTAGG - Intergenic
933213027 2:79593582-79593604 CAAGGACAGGATGACATGGTGGG - Intronic
933294545 2:80474255-80474277 CAGACACCAAGTGACATGGTTGG + Intronic
933513226 2:83267379-83267401 AAGGGGACAGATGACATAGTGGG + Intergenic
935725737 2:106022323-106022345 TAGGGAGCAGATTTCATGGTGGG + Intergenic
936637387 2:114274319-114274341 CATGGACGTGATGACATGGATGG - Intergenic
939558006 2:143700444-143700466 AAGGGACCAGTTGACATTGAGGG - Intronic
941654471 2:168128125-168128147 CAGGGACCAGCTAACAGGATGGG + Intronic
942127896 2:172845865-172845887 CAGGAACCAGATGAATTGGCAGG - Intronic
942419695 2:175795296-175795318 AAGGGACCAGAGGAAATGGAAGG - Intergenic
947668304 2:231920682-231920704 CAGGGGACAGATGACAGGGAAGG + Intergenic
948533282 2:238627439-238627461 CAGGGACCAGATGTGATGGTTGG + Intergenic
948794060 2:240393119-240393141 CAGTGACCAGGTGACAGGGAAGG - Intergenic
1169906727 20:10612076-10612098 TGGGGACCAGATGAGATGTTGGG + Intronic
1170603996 20:17862527-17862549 CAGGGAACAGATGAAGTCGTGGG + Intergenic
1170793489 20:19526661-19526683 GAGGGTCCACATGGCATGGTGGG + Intronic
1172066406 20:32223741-32223763 CATGGACCTTATCACATGGTAGG - Intronic
1173083474 20:39891997-39892019 AAGGGAGCAGAGGCCATGGTAGG - Intergenic
1173781133 20:45758399-45758421 CAGGGACCAGGTACCAGGGTGGG + Intronic
1173863486 20:46299170-46299192 CAGGGCACAGAGGACATGGAGGG - Intronic
1175254434 20:57630847-57630869 CAGAGACCACATGGCAAGGTTGG - Intergenic
1176170071 20:63692750-63692772 CAGGGACCAGATGATGAGGCTGG + Intronic
1181750375 22:24985013-24985035 CCGGGCCCAGATGAAATGGCAGG + Intronic
1184730606 22:46369132-46369154 CAGGGCCCAGCCGACATGGCTGG + Intronic
1185094078 22:48796517-48796539 CAGGGTCCAGATCTCATGGGAGG - Intronic
949514467 3:4794685-4794707 CTGGGACCAGATGAGATGCCCGG - Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
952885732 3:38010024-38010046 CAGGGATAGGATGACAGGGTAGG + Exonic
953607138 3:44419484-44419506 CAGGGCCCAGATGACCTTGCAGG + Intergenic
953958728 3:47250893-47250915 CAGTGCCCAGGTGACCTGGTTGG - Intronic
954322585 3:49842199-49842221 CTGTGGCCAGATGACCTGGTGGG - Intronic
954363424 3:50134224-50134246 CAGAGACCAGATGATTTGTTTGG + Intergenic
954465966 3:50654955-50654977 CAGGGACCAGAGGCCATAGAAGG - Intergenic
956764148 3:72469969-72469991 CAGGGGACATATGACATGGTGGG - Intergenic
957579383 3:82051203-82051225 CAGAGACAAGATCACATGGCTGG - Intergenic
958083722 3:88779929-88779951 CAGGGACAGAATGATATGGTAGG - Intergenic
958705338 3:97646954-97646976 CAGGGGCCACATGACATACTGGG + Intronic
959170916 3:102842566-102842588 CAAGAGCCAGATGCCATGGTGGG + Intergenic
964073881 3:152669439-152669461 CATGGACCTAAAGACATGGTTGG - Intergenic
965394246 3:168142849-168142871 CAGGAACCGGACGAAATGGTCGG - Intergenic
968708790 4:2097262-2097284 CAGGGACCAGGTCCCATGCTAGG + Intronic
969314542 4:6373667-6373689 CAGGGAACAGCTGAGATGGGAGG + Intronic
971800129 4:31278540-31278562 AAGGGACCAGATGATATTGAAGG + Intergenic
973532972 4:51851453-51851475 CAGCGACAACATGGCATGGTGGG + Intronic
974747484 4:66094286-66094308 CAGGGACCAGACAACATGGTCGG - Intergenic
975666339 4:76738869-76738891 CAGGGGAAAGATGACAGGGTGGG - Exonic
981411871 4:144441959-144441981 CAGGGGCAAAATGATATGGTTGG - Intergenic
981620501 4:146692650-146692672 CAGGGGCAAGTTGACATGCTGGG + Intergenic
981767926 4:148273500-148273522 AAGGGATCAGATGGCATGTTGGG + Intronic
985033529 4:185816289-185816311 CAGGGACCAGATCCTTTGGTGGG - Intronic
985592629 5:773547-773569 CAGGGCACAGCTGAGATGGTGGG - Intergenic
985711113 5:1430507-1430529 AAGGGACCAGTTCTCATGGTGGG - Intronic
994539133 5:101072360-101072382 CAGGGATAAGATGACTCGGTAGG - Intergenic
994878254 5:105451987-105452009 CAGGGACAGAATGATATGGTTGG + Intergenic
995451700 5:112309439-112309461 GACAGACCAGATGACGTGGTAGG + Intronic
999132242 5:149293072-149293094 CAGGGACAAGAGGGCATGGTGGG - Intronic
999943134 5:156566397-156566419 CAGGGATTTGATGACATGCTGGG - Intronic
1003689347 6:8337297-8337319 CAGGGGCCAGCTGACCCGGTTGG - Intergenic
1003692470 6:8368054-8368076 CAGGGACCATGTGACAAGCTGGG - Intergenic
1006522048 6:34576471-34576493 CAGGGATCAGACGACACGGTCGG + Intergenic
1008536966 6:52513717-52513739 CAGGGCCCAGATCACATGAATGG + Intronic
1010088769 6:71953358-71953380 CAAGGCCCAGTTCACATGGTGGG + Intronic
1013707458 6:112854921-112854943 GAGGGAGCAGATGTTATGGTGGG + Intergenic
1017125489 6:151060527-151060549 CAGGGAGCAGATGCCATGGGGGG + Intronic
1017237837 6:152135849-152135871 CAGGAACCAGATGGCTTTGTAGG - Intronic
1018099998 6:160429079-160429101 CAGGAACCAGAGGGCCTGGTGGG - Intronic
1018206921 6:161445070-161445092 CAGGGACCAGATGCCAGGGCTGG + Intronic
1018794981 6:167178966-167178988 CAGGGACCTTATGACAAGGGAGG + Intronic
1019519493 7:1454354-1454376 CAGGGACCAGATGGCACAGTCGG + Intronic
1019664234 7:2243382-2243404 AAGGGACCAGATGATAAGGAAGG - Intronic
1021606651 7:22415098-22415120 CAGGTTCCAGATGTCAGGGTGGG - Intergenic
1023357737 7:39384277-39384299 CATGGACCAGACAACATGGCTGG + Intronic
1025104989 7:56163301-56163323 CAGGGACCAGACAACATGGTTGG - Intergenic
1031388967 7:121189518-121189540 GAGGGACCTGGTGACCTGGTGGG - Intronic
1031688823 7:124764618-124764640 CAGGGGCCAGGTGGCCTGGTTGG + Exonic
1032866587 7:135931426-135931448 CAGGGAGGAGATGACATTTTAGG + Intronic
1033660892 7:143401292-143401314 CAGGACCCAGATGGCATGGAGGG + Intronic
1034998989 7:155596393-155596415 CAGGGACCAGGTGAAAGGGAGGG - Intergenic
1035430521 7:158816669-158816691 GAGGGAAAGGATGACATGGTTGG - Intronic
1035576400 8:709492-709514 CAGGGAGCAAATGAGAAGGTTGG - Intronic
1038419175 8:27421206-27421228 TAGGGACCAGATGATATCATTGG + Intronic
1039592466 8:38760926-38760948 CATGAACCAGATGCCATGCTGGG + Intronic
1041712375 8:60906221-60906243 CGGGGACCAGATGACATGGTCGG - Intergenic
1042229814 8:66544246-66544268 CAGGGTCCAGCTCACAGGGTGGG + Intergenic
1045659565 8:104423251-104423273 CAGGGACCAGTTCACATGGTTGG - Intronic
1047967022 8:130052934-130052956 GAGGAACCAGTTGACATGCTGGG - Exonic
1050151985 9:2626076-2626098 CAGGAACCAAATGAGATGGCAGG + Intronic
1050428532 9:5537310-5537332 GAAGAACCATATGACATGGTTGG - Intronic
1052979791 9:34439796-34439818 CAGGAGCCAGATCACATGTTAGG + Intronic
1053426542 9:38013975-38013997 CAGGGACCAGACTCCATGCTGGG - Intronic
1055350692 9:75383973-75383995 AAGAGACCAAATGACATGCTCGG - Intergenic
1057911208 9:99021790-99021812 CAGGGCCCAGATCAGAGGGTGGG + Intronic
1059328864 9:113522639-113522661 CAGAGACCAGCTGCCATGGAGGG + Intronic
1060247985 9:121962390-121962412 CAGGAAGCAGGTGACAGGGTTGG - Intronic
1186445174 X:9621061-9621083 GAGAGACGAGATGCCATGGTTGG + Intronic
1186670929 X:11766632-11766654 GAGGCACCAGGTGACATCGTCGG - Intronic
1186732839 X:12428856-12428878 CAAGGACCACATGACATTGGGGG - Intronic
1188198550 X:27270472-27270494 CAGTGACCTGATTACATTGTTGG - Intergenic
1189180132 X:38996162-38996184 CAGGGGCCAGGTGACAATGTAGG + Intergenic
1189577704 X:42372866-42372888 CAGTGTCAAGGTGACATGGTAGG + Intergenic
1190436605 X:50431807-50431829 CAGGGTCCTGTTGACATGGCAGG + Intronic
1195302059 X:103539640-103539662 CAAGGAACAGAAGCCATGGTAGG - Intergenic
1197310866 X:124903729-124903751 CAGGGACTAGAAAAGATGGTGGG + Intronic
1198063525 X:133071966-133071988 CAGGGGCCACAGTACATGGTAGG + Intronic
1198090751 X:133326872-133326894 CATGGACCAGATGACATTTAAGG - Intronic
1199819503 X:151430730-151430752 CAGGGACCAGATTATGTGCTTGG + Intergenic
1201759850 Y:17524751-17524773 CAGGGAAAAAATGACATGCTGGG + Intergenic
1201841704 Y:18381239-18381261 CAGGGAAAAAATGACATGCTGGG - Intergenic