ID: 1141570324

View in Genome Browser
Species Human (GRCh38)
Location 16:84930095-84930117
Sequence GCATTTGCAGCCGTTGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141570324_1141570334 16 Left 1141570324 16:84930095-84930117 CCCCAGCCAACGGCTGCAAATGC No data
Right 1141570334 16:84930134-84930156 CTAACACGTGGAAGGCCCCAGGG No data
1141570324_1141570330 8 Left 1141570324 16:84930095-84930117 CCCCAGCCAACGGCTGCAAATGC No data
Right 1141570330 16:84930126-84930148 AAACCAGCCTAACACGTGGAAGG No data
1141570324_1141570333 15 Left 1141570324 16:84930095-84930117 CCCCAGCCAACGGCTGCAAATGC No data
Right 1141570333 16:84930133-84930155 CCTAACACGTGGAAGGCCCCAGG No data
1141570324_1141570329 4 Left 1141570324 16:84930095-84930117 CCCCAGCCAACGGCTGCAAATGC No data
Right 1141570329 16:84930122-84930144 GCTGAAACCAGCCTAACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141570324 Original CRISPR GCATTTGCAGCCGTTGGCTG GGG (reversed) Intergenic
No off target data available for this crispr