ID: 1141571084

View in Genome Browser
Species Human (GRCh38)
Location 16:84934025-84934047
Sequence CGGCTGGGCGGCGGATAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141571084_1141571094 11 Left 1141571084 16:84934025-84934047 CCAGGCTATCCGCCGCCCAGCCG No data
Right 1141571094 16:84934059-84934081 CTGACTCTGGCCTGCCTGCCTGG No data
1141571084_1141571095 16 Left 1141571084 16:84934025-84934047 CCAGGCTATCCGCCGCCCAGCCG No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data
1141571084_1141571091 -2 Left 1141571084 16:84934025-84934047 CCAGGCTATCCGCCGCCCAGCCG No data
Right 1141571091 16:84934046-84934068 CGGTATCCCAGTGCTGACTCTGG No data
1141571084_1141571097 23 Left 1141571084 16:84934025-84934047 CCAGGCTATCCGCCGCCCAGCCG No data
Right 1141571097 16:84934071-84934093 TGCCTGCCTGGCGTGGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141571084 Original CRISPR CGGCTGGGCGGCGGATAGCC TGG (reversed) Intergenic
No off target data available for this crispr