ID: 1141571087

View in Genome Browser
Species Human (GRCh38)
Location 16:84934037-84934059
Sequence GCACTGGGATACCGGCTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141571087_1141571094 -1 Left 1141571087 16:84934037-84934059 CCGCCCAGCCGGTATCCCAGTGC No data
Right 1141571094 16:84934059-84934081 CTGACTCTGGCCTGCCTGCCTGG No data
1141571087_1141571101 30 Left 1141571087 16:84934037-84934059 CCGCCCAGCCGGTATCCCAGTGC No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571087_1141571097 11 Left 1141571087 16:84934037-84934059 CCGCCCAGCCGGTATCCCAGTGC No data
Right 1141571097 16:84934071-84934093 TGCCTGCCTGGCGTGGCTTCCGG No data
1141571087_1141571095 4 Left 1141571087 16:84934037-84934059 CCGCCCAGCCGGTATCCCAGTGC No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141571087 Original CRISPR GCACTGGGATACCGGCTGGG CGG (reversed) Intergenic
No off target data available for this crispr