ID: 1141571089

View in Genome Browser
Species Human (GRCh38)
Location 16:84934041-84934063
Sequence GTCAGCACTGGGATACCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141571089_1141571097 7 Left 1141571089 16:84934041-84934063 CCAGCCGGTATCCCAGTGCTGAC No data
Right 1141571097 16:84934071-84934093 TGCCTGCCTGGCGTGGCTTCCGG No data
1141571089_1141571101 26 Left 1141571089 16:84934041-84934063 CCAGCCGGTATCCCAGTGCTGAC No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571089_1141571095 0 Left 1141571089 16:84934041-84934063 CCAGCCGGTATCCCAGTGCTGAC No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data
1141571089_1141571094 -5 Left 1141571089 16:84934041-84934063 CCAGCCGGTATCCCAGTGCTGAC No data
Right 1141571094 16:84934059-84934081 CTGACTCTGGCCTGCCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141571089 Original CRISPR GTCAGCACTGGGATACCGGC TGG (reversed) Intergenic
No off target data available for this crispr