ID: 1141571090

View in Genome Browser
Species Human (GRCh38)
Location 16:84934045-84934067
Sequence CAGAGTCAGCACTGGGATAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141571090_1141571094 -9 Left 1141571090 16:84934045-84934067 CCGGTATCCCAGTGCTGACTCTG No data
Right 1141571094 16:84934059-84934081 CTGACTCTGGCCTGCCTGCCTGG No data
1141571090_1141571101 22 Left 1141571090 16:84934045-84934067 CCGGTATCCCAGTGCTGACTCTG No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571090_1141571103 27 Left 1141571090 16:84934045-84934067 CCGGTATCCCAGTGCTGACTCTG No data
Right 1141571103 16:84934095-84934117 CTGTCGTCAGCTGCTTGGTCTGG No data
1141571090_1141571095 -4 Left 1141571090 16:84934045-84934067 CCGGTATCCCAGTGCTGACTCTG No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data
1141571090_1141571097 3 Left 1141571090 16:84934045-84934067 CCGGTATCCCAGTGCTGACTCTG No data
Right 1141571097 16:84934071-84934093 TGCCTGCCTGGCGTGGCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141571090 Original CRISPR CAGAGTCAGCACTGGGATAC CGG (reversed) Intergenic
No off target data available for this crispr