ID: 1141571091

View in Genome Browser
Species Human (GRCh38)
Location 16:84934046-84934068
Sequence CGGTATCCCAGTGCTGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141571082_1141571091 5 Left 1141571082 16:84934018-84934040 CCCGCTGCCAGGCTATCCGCCGC No data
Right 1141571091 16:84934046-84934068 CGGTATCCCAGTGCTGACTCTGG No data
1141571078_1141571091 29 Left 1141571078 16:84933994-84934016 CCCTGGGCTAGGGGGTGGCTCCT No data
Right 1141571091 16:84934046-84934068 CGGTATCCCAGTGCTGACTCTGG No data
1141571077_1141571091 30 Left 1141571077 16:84933993-84934015 CCCCTGGGCTAGGGGGTGGCTCC No data
Right 1141571091 16:84934046-84934068 CGGTATCCCAGTGCTGACTCTGG No data
1141571084_1141571091 -2 Left 1141571084 16:84934025-84934047 CCAGGCTATCCGCCGCCCAGCCG No data
Right 1141571091 16:84934046-84934068 CGGTATCCCAGTGCTGACTCTGG No data
1141571081_1141571091 9 Left 1141571081 16:84934014-84934036 CCTGCCCGCTGCCAGGCTATCCG No data
Right 1141571091 16:84934046-84934068 CGGTATCCCAGTGCTGACTCTGG No data
1141571083_1141571091 4 Left 1141571083 16:84934019-84934041 CCGCTGCCAGGCTATCCGCCGCC No data
Right 1141571091 16:84934046-84934068 CGGTATCCCAGTGCTGACTCTGG No data
1141571079_1141571091 28 Left 1141571079 16:84933995-84934017 CCTGGGCTAGGGGGTGGCTCCTG No data
Right 1141571091 16:84934046-84934068 CGGTATCCCAGTGCTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141571091 Original CRISPR CGGTATCCCAGTGCTGACTC TGG Intergenic
No off target data available for this crispr