ID: 1141571092

View in Genome Browser
Species Human (GRCh38)
Location 16:84934052-84934074
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141571092_1141571097 -4 Left 1141571092 16:84934052-84934074 CCCAGTGCTGACTCTGGCCTGCC No data
Right 1141571097 16:84934071-84934093 TGCCTGCCTGGCGTGGCTTCCGG No data
1141571092_1141571106 30 Left 1141571092 16:84934052-84934074 CCCAGTGCTGACTCTGGCCTGCC No data
Right 1141571106 16:84934105-84934127 CTGCTTGGTCTGGAGCCTAGGGG No data
1141571092_1141571103 20 Left 1141571092 16:84934052-84934074 CCCAGTGCTGACTCTGGCCTGCC No data
Right 1141571103 16:84934095-84934117 CTGTCGTCAGCTGCTTGGTCTGG No data
1141571092_1141571104 28 Left 1141571092 16:84934052-84934074 CCCAGTGCTGACTCTGGCCTGCC No data
Right 1141571104 16:84934103-84934125 AGCTGCTTGGTCTGGAGCCTAGG No data
1141571092_1141571101 15 Left 1141571092 16:84934052-84934074 CCCAGTGCTGACTCTGGCCTGCC No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571092_1141571105 29 Left 1141571092 16:84934052-84934074 CCCAGTGCTGACTCTGGCCTGCC No data
Right 1141571105 16:84934104-84934126 GCTGCTTGGTCTGGAGCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141571092 Original CRISPR GGCAGGCCAGAGTCAGCACT GGG (reversed) Intergenic
No off target data available for this crispr