ID: 1141571095

View in Genome Browser
Species Human (GRCh38)
Location 16:84934064-84934086
Sequence TCTGGCCTGCCTGCCTGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141571086_1141571095 7 Left 1141571086 16:84934034-84934056 CCGCCGCCCAGCCGGTATCCCAG No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data
1141571090_1141571095 -4 Left 1141571090 16:84934045-84934067 CCGGTATCCCAGTGCTGACTCTG No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data
1141571081_1141571095 27 Left 1141571081 16:84934014-84934036 CCTGCCCGCTGCCAGGCTATCCG No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data
1141571084_1141571095 16 Left 1141571084 16:84934025-84934047 CCAGGCTATCCGCCGCCCAGCCG No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data
1141571082_1141571095 23 Left 1141571082 16:84934018-84934040 CCCGCTGCCAGGCTATCCGCCGC No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data
1141571088_1141571095 1 Left 1141571088 16:84934040-84934062 CCCAGCCGGTATCCCAGTGCTGA No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data
1141571087_1141571095 4 Left 1141571087 16:84934037-84934059 CCGCCCAGCCGGTATCCCAGTGC No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data
1141571089_1141571095 0 Left 1141571089 16:84934041-84934063 CCAGCCGGTATCCCAGTGCTGAC No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data
1141571083_1141571095 22 Left 1141571083 16:84934019-84934041 CCGCTGCCAGGCTATCCGCCGCC No data
Right 1141571095 16:84934064-84934086 TCTGGCCTGCCTGCCTGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141571095 Original CRISPR TCTGGCCTGCCTGCCTGGCG TGG Intergenic
No off target data available for this crispr