ID: 1141571099

View in Genome Browser
Species Human (GRCh38)
Location 16:84934077-84934099
Sequence GACAGGCCGGAAGCCACGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141571099_1141571101 -10 Left 1141571099 16:84934077-84934099 CCTGGCGTGGCTTCCGGCCTGTC No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571099_1141571107 15 Left 1141571099 16:84934077-84934099 CCTGGCGTGGCTTCCGGCCTGTC No data
Right 1141571107 16:84934115-84934137 TGGAGCCTAGGGGCTGACCTTGG No data
1141571099_1141571105 4 Left 1141571099 16:84934077-84934099 CCTGGCGTGGCTTCCGGCCTGTC No data
Right 1141571105 16:84934104-84934126 GCTGCTTGGTCTGGAGCCTAGGG No data
1141571099_1141571103 -5 Left 1141571099 16:84934077-84934099 CCTGGCGTGGCTTCCGGCCTGTC No data
Right 1141571103 16:84934095-84934117 CTGTCGTCAGCTGCTTGGTCTGG No data
1141571099_1141571104 3 Left 1141571099 16:84934077-84934099 CCTGGCGTGGCTTCCGGCCTGTC No data
Right 1141571104 16:84934103-84934125 AGCTGCTTGGTCTGGAGCCTAGG No data
1141571099_1141571109 28 Left 1141571099 16:84934077-84934099 CCTGGCGTGGCTTCCGGCCTGTC No data
Right 1141571109 16:84934128-84934150 CTGACCTTGGCCTGTCAGCCTGG No data
1141571099_1141571106 5 Left 1141571099 16:84934077-84934099 CCTGGCGTGGCTTCCGGCCTGTC No data
Right 1141571106 16:84934105-84934127 CTGCTTGGTCTGGAGCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141571099 Original CRISPR GACAGGCCGGAAGCCACGCC AGG (reversed) Intergenic
No off target data available for this crispr