ID: 1141571101

View in Genome Browser
Species Human (GRCh38)
Location 16:84934090-84934112
Sequence CCGGCCTGTCGTCAGCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141571098_1141571101 -6 Left 1141571098 16:84934073-84934095 CCTGCCTGGCGTGGCTTCCGGCC No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571099_1141571101 -10 Left 1141571099 16:84934077-84934099 CCTGGCGTGGCTTCCGGCCTGTC No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571089_1141571101 26 Left 1141571089 16:84934041-84934063 CCAGCCGGTATCCCAGTGCTGAC No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571096_1141571101 -2 Left 1141571096 16:84934069-84934091 CCTGCCTGCCTGGCGTGGCTTCC No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571090_1141571101 22 Left 1141571090 16:84934045-84934067 CCGGTATCCCAGTGCTGACTCTG No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571087_1141571101 30 Left 1141571087 16:84934037-84934059 CCGCCCAGCCGGTATCCCAGTGC No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571092_1141571101 15 Left 1141571092 16:84934052-84934074 CCCAGTGCTGACTCTGGCCTGCC No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571093_1141571101 14 Left 1141571093 16:84934053-84934075 CCAGTGCTGACTCTGGCCTGCCT No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data
1141571088_1141571101 27 Left 1141571088 16:84934040-84934062 CCCAGCCGGTATCCCAGTGCTGA No data
Right 1141571101 16:84934090-84934112 CCGGCCTGTCGTCAGCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141571101 Original CRISPR CCGGCCTGTCGTCAGCTGCT TGG Intergenic
No off target data available for this crispr