ID: 1141571103

View in Genome Browser
Species Human (GRCh38)
Location 16:84934095-84934117
Sequence CTGTCGTCAGCTGCTTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141571093_1141571103 19 Left 1141571093 16:84934053-84934075 CCAGTGCTGACTCTGGCCTGCCT No data
Right 1141571103 16:84934095-84934117 CTGTCGTCAGCTGCTTGGTCTGG No data
1141571099_1141571103 -5 Left 1141571099 16:84934077-84934099 CCTGGCGTGGCTTCCGGCCTGTC No data
Right 1141571103 16:84934095-84934117 CTGTCGTCAGCTGCTTGGTCTGG No data
1141571098_1141571103 -1 Left 1141571098 16:84934073-84934095 CCTGCCTGGCGTGGCTTCCGGCC No data
Right 1141571103 16:84934095-84934117 CTGTCGTCAGCTGCTTGGTCTGG No data
1141571090_1141571103 27 Left 1141571090 16:84934045-84934067 CCGGTATCCCAGTGCTGACTCTG No data
Right 1141571103 16:84934095-84934117 CTGTCGTCAGCTGCTTGGTCTGG No data
1141571096_1141571103 3 Left 1141571096 16:84934069-84934091 CCTGCCTGCCTGGCGTGGCTTCC No data
Right 1141571103 16:84934095-84934117 CTGTCGTCAGCTGCTTGGTCTGG No data
1141571092_1141571103 20 Left 1141571092 16:84934052-84934074 CCCAGTGCTGACTCTGGCCTGCC No data
Right 1141571103 16:84934095-84934117 CTGTCGTCAGCTGCTTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141571103 Original CRISPR CTGTCGTCAGCTGCTTGGTC TGG Intergenic
No off target data available for this crispr