ID: 1141574169

View in Genome Browser
Species Human (GRCh38)
Location 16:84953561-84953583
Sequence GGTCAGGTCACGTGTGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141574169_1141574176 -2 Left 1141574169 16:84953561-84953583 CCAGAGCCACACGTGACCTGACC No data
Right 1141574176 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
1141574169_1141574177 21 Left 1141574169 16:84953561-84953583 CCAGAGCCACACGTGACCTGACC No data
Right 1141574177 16:84953605-84953627 ACACGTGCAAGATGCAGCCCTGG No data
1141574169_1141574179 23 Left 1141574169 16:84953561-84953583 CCAGAGCCACACGTGACCTGACC No data
Right 1141574179 16:84953607-84953629 ACGTGCAAGATGCAGCCCTGGGG No data
1141574169_1141574178 22 Left 1141574169 16:84953561-84953583 CCAGAGCCACACGTGACCTGACC No data
Right 1141574178 16:84953606-84953628 CACGTGCAAGATGCAGCCCTGGG No data
1141574169_1141574174 -3 Left 1141574169 16:84953561-84953583 CCAGAGCCACACGTGACCTGACC No data
Right 1141574174 16:84953581-84953603 ACCACAGTGGAAATCAGACAGGG No data
1141574169_1141574173 -4 Left 1141574169 16:84953561-84953583 CCAGAGCCACACGTGACCTGACC No data
Right 1141574173 16:84953580-84953602 GACCACAGTGGAAATCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141574169 Original CRISPR GGTCAGGTCACGTGTGGCTC TGG (reversed) Intergenic