ID: 1141574170

View in Genome Browser
Species Human (GRCh38)
Location 16:84953567-84953589
Sequence CACTGTGGTCAGGTCACGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141574170_1141574176 -8 Left 1141574170 16:84953567-84953589 CCACACGTGACCTGACCACAGTG No data
Right 1141574176 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
1141574170_1141574177 15 Left 1141574170 16:84953567-84953589 CCACACGTGACCTGACCACAGTG No data
Right 1141574177 16:84953605-84953627 ACACGTGCAAGATGCAGCCCTGG No data
1141574170_1141574180 26 Left 1141574170 16:84953567-84953589 CCACACGTGACCTGACCACAGTG No data
Right 1141574180 16:84953616-84953638 ATGCAGCCCTGGGGACAGAAAGG No data
1141574170_1141574173 -10 Left 1141574170 16:84953567-84953589 CCACACGTGACCTGACCACAGTG No data
Right 1141574173 16:84953580-84953602 GACCACAGTGGAAATCAGACAGG No data
1141574170_1141574179 17 Left 1141574170 16:84953567-84953589 CCACACGTGACCTGACCACAGTG No data
Right 1141574179 16:84953607-84953629 ACGTGCAAGATGCAGCCCTGGGG No data
1141574170_1141574178 16 Left 1141574170 16:84953567-84953589 CCACACGTGACCTGACCACAGTG No data
Right 1141574178 16:84953606-84953628 CACGTGCAAGATGCAGCCCTGGG No data
1141574170_1141574174 -9 Left 1141574170 16:84953567-84953589 CCACACGTGACCTGACCACAGTG No data
Right 1141574174 16:84953581-84953603 ACCACAGTGGAAATCAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141574170 Original CRISPR CACTGTGGTCAGGTCACGTG TGG (reversed) Intergenic