ID: 1141574172

View in Genome Browser
Species Human (GRCh38)
Location 16:84953577-84953599
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141574172_1141574177 5 Left 1141574172 16:84953577-84953599 CCTGACCACAGTGGAAATCAGAC No data
Right 1141574177 16:84953605-84953627 ACACGTGCAAGATGCAGCCCTGG No data
1141574172_1141574179 7 Left 1141574172 16:84953577-84953599 CCTGACCACAGTGGAAATCAGAC No data
Right 1141574179 16:84953607-84953629 ACGTGCAAGATGCAGCCCTGGGG No data
1141574172_1141574178 6 Left 1141574172 16:84953577-84953599 CCTGACCACAGTGGAAATCAGAC No data
Right 1141574178 16:84953606-84953628 CACGTGCAAGATGCAGCCCTGGG No data
1141574172_1141574183 28 Left 1141574172 16:84953577-84953599 CCTGACCACAGTGGAAATCAGAC No data
Right 1141574183 16:84953628-84953650 GGACAGAAAGGCAAACAGCAAGG No data
1141574172_1141574180 16 Left 1141574172 16:84953577-84953599 CCTGACCACAGTGGAAATCAGAC No data
Right 1141574180 16:84953616-84953638 ATGCAGCCCTGGGGACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141574172 Original CRISPR GTCTGATTTCCACTGTGGTC AGG (reversed) Intergenic