ID: 1141574175

View in Genome Browser
Species Human (GRCh38)
Location 16:84953582-84953604
Sequence CCCCTGTCTGATTTCCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141574175_1141574185 29 Left 1141574175 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
Right 1141574185 16:84953634-84953656 AAAGGCAAACAGCAAGGAGGCGG No data
1141574175_1141574180 11 Left 1141574175 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
Right 1141574180 16:84953616-84953638 ATGCAGCCCTGGGGACAGAAAGG No data
1141574175_1141574179 2 Left 1141574175 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
Right 1141574179 16:84953607-84953629 ACGTGCAAGATGCAGCCCTGGGG No data
1141574175_1141574183 23 Left 1141574175 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
Right 1141574183 16:84953628-84953650 GGACAGAAAGGCAAACAGCAAGG No data
1141574175_1141574184 26 Left 1141574175 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
Right 1141574184 16:84953631-84953653 CAGAAAGGCAAACAGCAAGGAGG No data
1141574175_1141574177 0 Left 1141574175 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
Right 1141574177 16:84953605-84953627 ACACGTGCAAGATGCAGCCCTGG No data
1141574175_1141574178 1 Left 1141574175 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
Right 1141574178 16:84953606-84953628 CACGTGCAAGATGCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141574175 Original CRISPR CCCCTGTCTGATTTCCACTG TGG (reversed) Intergenic