ID: 1141574178

View in Genome Browser
Species Human (GRCh38)
Location 16:84953606-84953628
Sequence CACGTGCAAGATGCAGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141574169_1141574178 22 Left 1141574169 16:84953561-84953583 CCAGAGCCACACGTGACCTGACC No data
Right 1141574178 16:84953606-84953628 CACGTGCAAGATGCAGCCCTGGG No data
1141574172_1141574178 6 Left 1141574172 16:84953577-84953599 CCTGACCACAGTGGAAATCAGAC No data
Right 1141574178 16:84953606-84953628 CACGTGCAAGATGCAGCCCTGGG No data
1141574168_1141574178 23 Left 1141574168 16:84953560-84953582 CCCAGAGCCACACGTGACCTGAC No data
Right 1141574178 16:84953606-84953628 CACGTGCAAGATGCAGCCCTGGG No data
1141574170_1141574178 16 Left 1141574170 16:84953567-84953589 CCACACGTGACCTGACCACAGTG No data
Right 1141574178 16:84953606-84953628 CACGTGCAAGATGCAGCCCTGGG No data
1141574175_1141574178 1 Left 1141574175 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
Right 1141574178 16:84953606-84953628 CACGTGCAAGATGCAGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141574178 Original CRISPR CACGTGCAAGATGCAGCCCT GGG Intergenic
No off target data available for this crispr