ID: 1141574180

View in Genome Browser
Species Human (GRCh38)
Location 16:84953616-84953638
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141574170_1141574180 26 Left 1141574170 16:84953567-84953589 CCACACGTGACCTGACCACAGTG No data
Right 1141574180 16:84953616-84953638 ATGCAGCCCTGGGGACAGAAAGG No data
1141574175_1141574180 11 Left 1141574175 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
Right 1141574180 16:84953616-84953638 ATGCAGCCCTGGGGACAGAAAGG No data
1141574172_1141574180 16 Left 1141574172 16:84953577-84953599 CCTGACCACAGTGGAAATCAGAC No data
Right 1141574180 16:84953616-84953638 ATGCAGCCCTGGGGACAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141574180 Original CRISPR ATGCAGCCCTGGGGACAGAA AGG Intergenic