ID: 1141574183

View in Genome Browser
Species Human (GRCh38)
Location 16:84953628-84953650
Sequence GGACAGAAAGGCAAACAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141574175_1141574183 23 Left 1141574175 16:84953582-84953604 CCACAGTGGAAATCAGACAGGGG No data
Right 1141574183 16:84953628-84953650 GGACAGAAAGGCAAACAGCAAGG No data
1141574172_1141574183 28 Left 1141574172 16:84953577-84953599 CCTGACCACAGTGGAAATCAGAC No data
Right 1141574183 16:84953628-84953650 GGACAGAAAGGCAAACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141574183 Original CRISPR GGACAGAAAGGCAAACAGCA AGG Intergenic
No off target data available for this crispr