ID: 1141576089

View in Genome Browser
Species Human (GRCh38)
Location 16:84964282-84964304
Sequence CAGCAAGCACGTGCTGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141576089_1141576091 0 Left 1141576089 16:84964282-84964304 CCTGTGCCAGCACGTGCTTGCTG No data
Right 1141576091 16:84964305-84964327 TTCATTCACTATGCCGTGCTAGG No data
1141576089_1141576095 23 Left 1141576089 16:84964282-84964304 CCTGTGCCAGCACGTGCTTGCTG No data
Right 1141576095 16:84964328-84964350 AGGCGATACCGCGAGGAACCAGG No data
1141576089_1141576094 16 Left 1141576089 16:84964282-84964304 CCTGTGCCAGCACGTGCTTGCTG No data
Right 1141576094 16:84964321-84964343 TGCTAGGAGGCGATACCGCGAGG No data
1141576089_1141576097 28 Left 1141576089 16:84964282-84964304 CCTGTGCCAGCACGTGCTTGCTG No data
Right 1141576097 16:84964333-84964355 ATACCGCGAGGAACCAGGGACGG No data
1141576089_1141576096 24 Left 1141576089 16:84964282-84964304 CCTGTGCCAGCACGTGCTTGCTG No data
Right 1141576096 16:84964329-84964351 GGCGATACCGCGAGGAACCAGGG No data
1141576089_1141576092 3 Left 1141576089 16:84964282-84964304 CCTGTGCCAGCACGTGCTTGCTG No data
Right 1141576092 16:84964308-84964330 ATTCACTATGCCGTGCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141576089 Original CRISPR CAGCAAGCACGTGCTGGCAC AGG (reversed) Intergenic
No off target data available for this crispr