ID: 1141579101

View in Genome Browser
Species Human (GRCh38)
Location 16:84985079-84985101
Sequence CAGTCCCACAAGAAGATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141579101_1141579103 -8 Left 1141579101 16:84985079-84985101 CCACTCATCTTCTTGTGGGACTG No data
Right 1141579103 16:84985094-84985116 TGGGACTGACCATAGGCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 130
1141579101_1141579108 10 Left 1141579101 16:84985079-84985101 CCACTCATCTTCTTGTGGGACTG No data
Right 1141579108 16:84985112-84985134 CCAGGCCATGGGATGCCTTCAGG 0: 1
1: 0
2: 3
3: 26
4: 241
1141579101_1141579104 -2 Left 1141579101 16:84985079-84985101 CCACTCATCTTCTTGTGGGACTG No data
Right 1141579104 16:84985100-84985122 TGACCATAGGCTCCAGGCCATGG 0: 1
1: 0
2: 1
3: 10
4: 173
1141579101_1141579105 -1 Left 1141579101 16:84985079-84985101 CCACTCATCTTCTTGTGGGACTG No data
Right 1141579105 16:84985101-84985123 GACCATAGGCTCCAGGCCATGGG 0: 1
1: 0
2: 1
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141579101 Original CRISPR CAGTCCCACAAGAAGATGAG TGG (reversed) Intronic
No off target data available for this crispr