ID: 1141579103

View in Genome Browser
Species Human (GRCh38)
Location 16:84985094-84985116
Sequence TGGGACTGACCATAGGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141579100_1141579103 -7 Left 1141579100 16:84985078-84985100 CCCACTCATCTTCTTGTGGGACT 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1141579103 16:84985094-84985116 TGGGACTGACCATAGGCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 130
1141579101_1141579103 -8 Left 1141579101 16:84985079-84985101 CCACTCATCTTCTTGTGGGACTG No data
Right 1141579103 16:84985094-84985116 TGGGACTGACCATAGGCTCCAGG 0: 1
1: 0
2: 1
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141579103 Original CRISPR TGGGACTGACCATAGGCTCC AGG Intronic
900616876 1:3569441-3569463 TGGGGCTGACCATGGCATCCGGG - Intronic
901538722 1:9900836-9900858 TGGCACTGCCCACAGCCTCCAGG - Intronic
901828533 1:11878480-11878502 TGGAACTGACCACAGCCTGCAGG - Intergenic
902392562 1:16115018-16115040 AGCGACTGACCATGGGCGCCCGG - Intergenic
903228060 1:21904906-21904928 TGGGCCTGCCCATACCCTCCTGG + Intronic
903326431 1:22571462-22571484 AGGGACTCACCACAGGCTCTGGG - Intronic
906556420 1:46718228-46718250 TGGGACTGACCAGATCCGCCAGG + Exonic
908553626 1:65234675-65234697 AGGGACTGACCCCAGGATCCTGG - Intergenic
911128455 1:94364410-94364432 TGGGACTGGCCCCAGGCCCCAGG - Intergenic
911359764 1:96862363-96862385 TGGGTCTGACCTCAGGCCCCTGG + Intergenic
912794935 1:112687508-112687530 TGGGAATGTCCTCAGGCTCCTGG + Intronic
913555078 1:119957915-119957937 TGGGAATGAGCATGGGCTCAGGG + Intronic
917790520 1:178496215-178496237 TGGAACTGACTAGAGGCTCCCGG - Intergenic
918043719 1:180928445-180928467 TGGGGCTCAGCACAGGCTCCGGG - Exonic
918688558 1:187450225-187450247 TGGGACTGACCATACCACCCTGG - Intergenic
920400584 1:205673692-205673714 TGGGACTGATCACAGACTCTAGG - Intronic
1067538600 10:47135549-47135571 TGGGACTGAGAAGAGGCTCTAGG - Intergenic
1072615992 10:97049227-97049249 CGTGGCTGACCCTAGGCTCCAGG - Intronic
1073604326 10:104878939-104878961 TGGGGCTTACCAGAGGTTCCTGG - Intronic
1076827837 10:132978732-132978754 TGGGAGTGAGCAGAGGCACCAGG + Intergenic
1077293893 11:1815098-1815120 AGGGACTGCTCATGGGCTCCCGG + Intergenic
1077408127 11:2391662-2391684 TGGCCCTGCCCATAGGTTCCTGG + Intronic
1078157312 11:8810011-8810033 TGGAACTCACCACAGGCTCCTGG + Intronic
1081787523 11:45757748-45757770 TGTGAAAGACCATAGGCTCTGGG - Intergenic
1081998764 11:47380836-47380858 TGGGACTCTCCAAAGGCTCCAGG + Intergenic
1083879914 11:65543299-65543321 TGGGACTGACCCAGGGCTCTGGG - Intronic
1085804185 11:79619412-79619434 GTGGAATGAACATAGGCTCCAGG - Intergenic
1088534539 11:110846196-110846218 TGGTGCTGACCATAGGGTCAAGG + Intergenic
1088580030 11:111306533-111306555 TGGAATTGAGCAAAGGCTCCGGG - Exonic
1088585751 11:111358936-111358958 TGAGAAGGACCATGGGCTCCAGG - Intronic
1092073195 12:5650085-5650107 TGGGACTGAACCAAGACTCCAGG - Intronic
1102376269 12:112423879-112423901 TGGGACTGACTACAGGCACGTGG + Intronic
1103549865 12:121729039-121729061 TAGGCCTGGCCACAGGCTCCAGG - Intronic
1104943181 12:132404336-132404358 TGGCACTGGCCACAGGCTTCTGG - Intergenic
1105825868 13:24122521-24122543 TGGCACTGACCAGAGGAACCGGG - Intronic
1111927544 13:94479179-94479201 GGGAACTGACCCTGGGCTCCTGG + Exonic
1114670145 14:24406635-24406657 GGGGACTGAGCAGAGGCACCTGG + Intronic
1115779583 14:36754612-36754634 GGGGACAGACCACAGGCTTCAGG - Intronic
1117453974 14:55879445-55879467 TGAGGCTGACCATCAGCTCCAGG + Intergenic
1118009512 14:61595292-61595314 TGGGGCTGCCCAGAGTCTCCTGG + Intronic
1120732929 14:88023087-88023109 TGGGACCGACCCTACTCTCCAGG - Intergenic
1120830884 14:88996469-88996491 AGGGACTTCCCATAGGTTCCTGG - Intergenic
1122044378 14:99012755-99012777 TGGGGCTGATCCCAGGCTCCTGG - Intergenic
1122465420 14:101930198-101930220 CGGGGCTGAGCATGGGCTCCGGG - Intergenic
1123988645 15:25667042-25667064 AGGGACTGACCATGGGCTTGAGG + Intergenic
1128360658 15:66959370-66959392 TCCACCTGACCATAGGCTCCTGG - Intergenic
1129608291 15:77035373-77035395 TGGGACTGCCCCTAGCCTCCAGG - Intronic
1139139894 16:64248541-64248563 TGGGGCTGACCAAATGCTACAGG - Intergenic
1140478604 16:75251039-75251061 GGGGACTGCCCACCGGCTCCCGG - Intronic
1141579103 16:84985094-84985116 TGGGACTGACCATAGGCTCCAGG + Intronic
1142233109 16:88909041-88909063 TGGAGCTGACCACAGGCCCCAGG + Intronic
1143544508 17:7588479-7588501 TCAGAGTGACCCTAGGCTCCAGG - Exonic
1143724352 17:8835238-8835260 TGGGACTGACAAGGGGCTGCAGG + Intronic
1144430194 17:15184146-15184168 TGGGAAGGCCCATAGGCTTCAGG - Intergenic
1149526573 17:57360447-57360469 TGGGGCTGTCCAAGGGCTCCAGG + Intronic
1150136308 17:62697178-62697200 TGGGACTGCCAAGAGGCCCCGGG + Intergenic
1158572964 18:58612221-58612243 TGGCACTAACCATAGCCTCATGG - Intronic
1159987806 18:74865111-74865133 TGGGACTCTCCTTAGGCACCTGG + Intronic
1160823299 19:1068002-1068024 TGGGGCTGCCCATAGGCTCTGGG + Intronic
1161169837 19:2807229-2807251 TGGGACTGACCCCAGGGCCCGGG - Intronic
1161514491 19:4689117-4689139 GGTGACTGTCCATAGGCCCCTGG - Intronic
1162790962 19:13062755-13062777 AGGGACTGACCCTGGGCTCATGG - Intronic
1163161010 19:15464181-15464203 GGGTGCTGACCATGGGCTCCTGG + Exonic
1163625303 19:18386142-18386164 TGGGACTGACCAGATGCTGCCGG - Exonic
925407247 2:3613612-3613634 TGGAACTCAGCAGAGGCTCCTGG + Intronic
927827153 2:26316861-26316883 AGTGAATGAACATAGGCTCCCGG - Intronic
930230689 2:48841207-48841229 GAGTACTCACCATAGGCTCCCGG - Intergenic
930984695 2:57570843-57570865 TGGGACAGAACACTGGCTCCAGG - Intergenic
938086509 2:128405545-128405567 TGGGCCTGTCCACAGGCTCAGGG + Intergenic
945930434 2:215849484-215849506 CGGGAATGACCATAGGATTCAGG - Intergenic
948627266 2:239276807-239276829 GGGGAATGACAACAGGCTCCAGG + Intronic
948733630 2:239983610-239983632 TGGCCCTGACCGTGGGCTCCTGG - Intronic
1170240843 20:14164668-14164690 TGGGCCTGACCGCAGGCTCTGGG + Intronic
1170551805 20:17483376-17483398 TGGGATTGACCATAACCTTCGGG - Exonic
1172093572 20:32449843-32449865 TGGGAGTGGCCAGAGCCTCCTGG + Intronic
1172564894 20:35921813-35921835 TGGAACTGAGCATATGCTCAAGG - Intronic
1175807189 20:61836144-61836166 TGGGCCTGCCCATCGGCTACGGG + Intronic
1176336776 21:5606264-5606286 TGGGGCTGCCCACAGCCTCCTGG + Intergenic
1176390981 21:6214684-6214706 TGGGGCTGCCCACAGCCTCCTGG - Intergenic
1176470438 21:7101490-7101512 TGGGGCTGCCCACAGCCTCCTGG + Intergenic
1176493999 21:7483268-7483290 TGGGGCTGCCCACAGCCTCCTGG + Intergenic
1176506643 21:7655115-7655137 TGGGGCTGCCCACAGCCTCCTGG - Intergenic
1179058450 21:37957185-37957207 TAGAACTGACCACAGGCTGCAGG + Intronic
1180174846 21:46082506-46082528 TGGGACTGACCACAGCCTCCCGG - Intergenic
1182311583 22:29412461-29412483 GGGGACTGACCCTAGGGTCCAGG + Intronic
1182557632 22:31137767-31137789 TGGGAGAGACCATAGGGTCCTGG + Exonic
1182688759 22:32141374-32141396 GGGGACTGACCCTAGGGTCCAGG - Intergenic
1182712890 22:32333554-32333576 TGGCCCTGATCATCGGCTCCTGG + Intergenic
1183658938 22:39207137-39207159 TGGGCCTGACCTGAGCCTCCTGG + Intergenic
1184853384 22:47133647-47133669 TGGGACTTACCGGCGGCTCCTGG + Intronic
950073483 3:10170779-10170801 GTGGGCTGACCAAAGGCTCCAGG - Intronic
953003303 3:38954406-38954428 TGTAACTGAGCATAGGGTCCAGG - Intergenic
953636532 3:44669825-44669847 TGGGCCTGTCCCTAGCCTCCAGG - Intergenic
966702205 3:182867057-182867079 TGGGACTGACTACAGGCACAGGG + Intronic
972325878 4:38014763-38014785 TGGGCCTGCGCACAGGCTCCTGG - Exonic
977629691 4:99228452-99228474 TGGGACAGAACAGAGGCTTCAGG - Intergenic
977926506 4:102705862-102705884 TGGGCCTGTCCTCAGGCTCCTGG - Intronic
980623703 4:135344538-135344560 TGGCTCTGTCTATAGGCTCCAGG - Intergenic
980698360 4:136390372-136390394 TGGGATTCACCATATGGTCCAGG - Intergenic
980863832 4:138530176-138530198 TGGGCCAGACCTTAGGCCCCTGG - Intergenic
983939165 4:173523368-173523390 TGGGACTGAACATACACTGCGGG - Intergenic
986790948 5:11159566-11159588 CAGGACTGACCTTAGGCACCCGG + Exonic
996311328 5:122109168-122109190 TGTCACTGGCCATAGGGTCCTGG - Intergenic
997195402 5:131975695-131975717 TGGGACTGACCCTAGGGACAGGG + Intronic
1002296709 5:178235412-178235434 TGGGACTGCACCTAGGCTCTTGG - Intergenic
1005956881 6:30670400-30670422 TGGGACTCACCATGGCCTTCCGG + Exonic
1006379540 6:33689490-33689512 TGGGACAGAGCAGTGGCTCCTGG - Intronic
1006716701 6:36124977-36124999 AGGGACTTACCAGAGGCTGCTGG + Intergenic
1007886108 6:45232456-45232478 TGTGCCTGATCATGGGCTCCAGG + Intronic
1019026686 6:168971465-168971487 TGGCCCTGACCCTAGGCTGCAGG + Intergenic
1020731330 7:11884709-11884731 TGGGACTTATCATAGGGTACAGG + Intergenic
1021891319 7:25188691-25188713 TGAGACTGTCCATGGGCTGCTGG - Intergenic
1021994432 7:26166228-26166250 TTGGAGTGCCCAGAGGCTCCCGG + Intronic
1029692300 7:102190521-102190543 AGGGTCTGACCACAGGCTCCAGG - Intronic
1033217713 7:139505566-139505588 TGGGAGTGACCAAAGGCCCATGG - Intergenic
1041290526 8:56304016-56304038 TGGGACAGAGCAAAGGATCCTGG - Intronic
1047030661 8:120876087-120876109 TGGTAGTTACCATAGGCTGCAGG - Intergenic
1050537948 9:6645994-6646016 TGGGACAGCCCAAAGACTCCGGG + Intergenic
1051380871 9:16457341-16457363 TGGGACTGATCTTAGGGACCTGG - Intronic
1052824620 9:33166346-33166368 GGGGACTGACGTGAGGCTCCCGG - Intronic
1053117347 9:35517160-35517182 TGGGTCTCACCAGAGGCTGCAGG + Intronic
1055439353 9:76323300-76323322 TGGGATTCAAAATAGGCTCCGGG + Intronic
1055553227 9:77450276-77450298 TGGGGCTGACCACAAGCCCCAGG - Intronic
1056900805 9:90597525-90597547 CGGGACTGGCCAGGGGCTCCTGG - Intergenic
1057042367 9:91857022-91857044 TGGGAGTGAACACAGGCTCTGGG - Intronic
1057610353 9:96537364-96537386 TGGGGCTGACCCTATGCCCCAGG + Intronic
1058356917 9:104094071-104094093 TGGGGCTGACCATAGAGTGCCGG + Intergenic
1058879786 9:109276463-109276485 TGGGAATGACTAGAGGGTCCTGG + Intronic
1062233718 9:135498052-135498074 TGAGCTTGACCTTAGGCTCCAGG - Intronic
1203424877 Un_GL000195v1:28638-28660 TGGGGCTGCCCACAGCCTCCTGG - Intergenic
1187428848 X:19203382-19203404 TATGCCTGACCAGAGGCTCCAGG - Intergenic
1189296847 X:39924546-39924568 TGGGTCTCTCCATAGGCTGCTGG - Intergenic
1189549823 X:42081404-42081426 TATCACTGACCATGGGCTCCAGG + Intergenic
1190039529 X:47058672-47058694 GGGGGCTGAACACAGGCTCCTGG - Exonic
1190560871 X:51683742-51683764 TGTGACTTACCACAGGCTCCTGG + Intergenic
1190563420 X:51709579-51709601 TGTGACTTACCACAGGCTCCTGG - Intergenic
1191995314 X:67089127-67089149 TGGGACTGTCCTCAGGCTCTTGG + Intergenic
1193017248 X:76749615-76749637 TGGGTCTGACCTGAGGCCCCAGG - Intergenic
1193600181 X:83501575-83501597 TGGACCTGACCTTAGCCTCCTGG - Intergenic
1193883834 X:86960541-86960563 TGGGGGTGGCCATGGGCTCCAGG + Intergenic
1195704957 X:107732084-107732106 TGGGACTGGCCCTTGGCTCCAGG + Intronic
1197352994 X:125400503-125400525 TGGGACATACCATAGGGCCCAGG + Intergenic
1198744634 X:139877176-139877198 TGGTACTGCACATAGGCCCCTGG - Intronic
1200143408 X:153913293-153913315 TGGGGCTGCCCAGAAGCTCCAGG - Exonic
1200217923 X:154376721-154376743 TGGGGCTGGACTTAGGCTCCAGG + Intergenic