ID: 1141579104

View in Genome Browser
Species Human (GRCh38)
Location 16:84985100-84985122
Sequence TGACCATAGGCTCCAGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141579101_1141579104 -2 Left 1141579101 16:84985079-84985101 CCACTCATCTTCTTGTGGGACTG No data
Right 1141579104 16:84985100-84985122 TGACCATAGGCTCCAGGCCATGG 0: 1
1: 0
2: 1
3: 10
4: 173
1141579100_1141579104 -1 Left 1141579100 16:84985078-84985100 CCCACTCATCTTCTTGTGGGACT 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1141579104 16:84985100-84985122 TGACCATAGGCTCCAGGCCATGG 0: 1
1: 0
2: 1
3: 10
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141579104 Original CRISPR TGACCATAGGCTCCAGGCCA TGG Intronic
900290739 1:1922561-1922583 TGCCTTTGGGCTCCAGGCCAGGG - Intronic
904280792 1:29416992-29417014 TCACCAGGAGCTCCAGGCCAGGG - Intergenic
905772128 1:40645158-40645180 TCATCATAGGCCCCAGTCCAGGG - Intronic
906288619 1:44604603-44604625 GAGCCAAAGGCTCCAGGCCAAGG - Intronic
907490169 1:54804243-54804265 TGACCAAAGGCTATAAGCCAAGG - Intergenic
915140416 1:153764485-153764507 TGGAGACAGGCTCCAGGCCAAGG - Intronic
918316442 1:183326544-183326566 TGTGCAAAGGCTCCAGGACAGGG + Intronic
921248702 1:213275877-213275899 TTACCAGAGGCTGCGGGCCAGGG - Intergenic
1063280926 10:4628509-4628531 GGAGCATAGGCTCCAGGCAGAGG - Intergenic
1063386677 10:5620328-5620350 TGACCTTGGCCTCCAGGTCAGGG + Intergenic
1064418139 10:15168356-15168378 TCACCATGGGCTCCGCGCCACGG + Intronic
1065087094 10:22189192-22189214 TGAACATAGGATTCAGGACAGGG + Intergenic
1065963781 10:30754638-30754660 TGGGCACAGGGTCCAGGCCATGG - Intergenic
1067224545 10:44367116-44367138 TGACCAGAGGCTGCTGCCCAGGG + Intergenic
1067845132 10:49713526-49713548 TGAGCACTGGCTCCAGGGCAGGG + Intergenic
1073445031 10:103575430-103575452 TGACCACAGGCTTCAGACAAAGG - Intronic
1074533164 10:114310730-114310752 TGACCAGAGCCACCAGCCCAGGG + Intronic
1075669098 10:124251022-124251044 CGAACATTGGCTCCAGACCAAGG + Intergenic
1076189858 10:128475362-128475384 TGACCATAGGCTCTAAGGCCAGG - Intergenic
1076934347 10:133557430-133557452 TTACCAGAGGCCCCAGGCCCTGG - Intronic
1077211347 11:1372194-1372216 GGAGGACAGGCTCCAGGCCAGGG + Intergenic
1081775306 11:45672025-45672047 TGCCCATGGGCTCCTGACCAAGG - Intergenic
1081998158 11:47377773-47377795 TGACCAAAGGGTCAGGGCCATGG - Intronic
1083340801 11:61957284-61957306 GGACCATAGGTACCAGGCCCTGG + Intronic
1084964924 11:72739486-72739508 TGTCCCTCGGCTCCAGGCCTGGG + Intronic
1085351572 11:75801240-75801262 TAAGCATGTGCTCCAGGCCAAGG - Exonic
1085757251 11:79212186-79212208 TGACCATCTGCTACATGCCAGGG - Intronic
1085804182 11:79619406-79619428 TGAACATAGGCTCCAGGGTTGGG - Intergenic
1086406555 11:86503890-86503912 TTCCTATAGGCTCCAGGCAATGG + Intronic
1086891406 11:92262496-92262518 TGACCTGAGGGACCAGGCCAAGG - Intergenic
1088534540 11:110846202-110846224 TGACCATAGGGTCAAGGTCCAGG + Intergenic
1089875381 11:121716450-121716472 TGAGCATAGGGTCCAAACCAGGG + Intergenic
1090412759 11:126520366-126520388 GGCCCATGGGCTCCTGGCCAGGG - Intronic
1094396201 12:30008590-30008612 TGAGCAGAGGCTCCAGACCAGGG - Intergenic
1096196512 12:49652089-49652111 TGTCCACAGACTCCAGGCCCCGG + Exonic
1096495263 12:52036295-52036317 TGACCAGAGTCTTCAGGCCCAGG - Intronic
1098509524 12:71295477-71295499 TGACCATAGGGGTCCGGCCAGGG - Intronic
1098677821 12:73313682-73313704 TGCCCATAGGCTCAAAGCAAAGG - Intergenic
1099925094 12:89007534-89007556 AGAACATAGGCTCTGGGCCAGGG - Intergenic
1100311361 12:93397806-93397828 TGAGCTTCTGCTCCAGGCCATGG + Intronic
1101407759 12:104443664-104443686 AGAACATAGCCTCCAGGCCTGGG + Intergenic
1101884772 12:108652677-108652699 TGAGCCTAGGCACCAGGCCAGGG + Intronic
1104101826 12:125619734-125619756 TGACCACAGGCTGCTGGACAGGG + Intronic
1104582086 12:130018396-130018418 TTACCATTAGCTCCAGGGCAAGG - Intergenic
1110819863 13:79901694-79901716 AGACCAGAGGCTTCAGGCAATGG - Intergenic
1116898335 14:50338557-50338579 TGCCCATGGTCTCCAGACCATGG - Intronic
1117730269 14:58715126-58715148 TGACCACAGAGACCAGGCCAGGG - Intergenic
1117871653 14:60207392-60207414 GGACCTTAGGCTCTAGGGCAGGG + Intergenic
1119540944 14:75437952-75437974 TGACCACAGGCTCCCTGCCAGGG + Exonic
1124215521 15:27805069-27805091 TGACCACTCGCTCCAGGGCAGGG - Intronic
1124695919 15:31864115-31864137 GGACAATAAGGTCCAGGCCAAGG - Intronic
1125277929 15:38013040-38013062 GGTCCATAGTCTGCAGGCCAAGG + Intergenic
1127152308 15:56089071-56089093 TGACCACATGCTCCAGGAAATGG + Exonic
1127630297 15:60821378-60821400 GGACCACAGGCGCCAGGACACGG - Intronic
1129710048 15:77816296-77816318 TGAAGCGAGGCTCCAGGCCATGG + Intronic
1129893418 15:79086957-79086979 TGAGCAAAGGGCCCAGGCCAGGG + Intronic
1130602078 15:85282899-85282921 TGGCCACAGGCTCCGTGCCAGGG - Intergenic
1130989596 15:88868401-88868423 TAACAACAGGCTCCAGGCCCTGG + Intronic
1131852282 15:96555813-96555835 TGGCCATCAGCTCCAGGCCAAGG - Intergenic
1132458812 16:39251-39273 TGGACATAGCCTCCAGCCCATGG + Intergenic
1133122098 16:3615366-3615388 TCACAATAGGGTCCAGGACAAGG - Intronic
1133272091 16:4615198-4615220 TGACCACAGGATCTTGGCCAAGG + Intergenic
1135495186 16:22945306-22945328 TGATCATAGGTTCCAGGGAAGGG - Intergenic
1137355299 16:47756750-47756772 AGATAATAGTCTCCAGGCCAAGG - Intergenic
1137972727 16:53001683-53001705 TGAGCACAGGCTCCAGGCTGGGG - Intergenic
1139354644 16:66360260-66360282 TGACCAATGGCTCCAGACAACGG + Intergenic
1139659827 16:68413082-68413104 TCCACATAGGCCCCAGGCCAAGG - Intronic
1140338890 16:74138096-74138118 TGGCCTCAGGCACCAGGCCAGGG + Intergenic
1141579104 16:84985100-84985122 TGACCATAGGCTCCAGGCCATGG + Intronic
1142233112 16:88909047-88909069 TGACCACAGGCCCCAGGCAGGGG + Intronic
1142236431 16:88924657-88924679 TGACCTCATGCTCCCGGCCATGG - Intronic
1143579671 17:7818197-7818219 TGTCCTAAGGCCCCAGGCCAGGG - Intronic
1144304195 17:13952431-13952453 TGACCTGGGGCTCCAGGCCCAGG - Intergenic
1146514007 17:33474689-33474711 TGACCAGAAGCTCAAGGGCAAGG + Intronic
1146794895 17:35773942-35773964 TGGCCATAGGCCCCAGGCCCTGG - Intronic
1147915484 17:43882971-43882993 TGAATGTAGGGTCCAGGCCAGGG + Exonic
1148241405 17:46001770-46001792 TGCCCCCAGGGTCCAGGCCAGGG + Intronic
1148861046 17:50604495-50604517 TGCCGAGAGGCTTCAGGCCATGG + Intronic
1150810377 17:68351706-68351728 TTGCGATAGGCTCCAGGACAAGG + Intronic
1151024525 17:70661721-70661743 CAACCATTGGCTCCAGGCCCTGG + Intergenic
1151312881 17:73304991-73305013 GAACCACAGGCTTCAGGCCAGGG + Intronic
1152422845 17:80203479-80203501 TGACTCCAGGCTGCAGGCCAGGG + Intronic
1153761927 18:8339817-8339839 AGAACATACCCTCCAGGCCAGGG - Intronic
1162164380 19:8742638-8742660 TGGGCAGGGGCTCCAGGCCATGG + Intergenic
1162165452 19:8750106-8750128 TGGGCAGGGGCTCCAGGCCATGG + Intergenic
1162166517 19:8757562-8757584 TGGGCAGGGGCTCCAGGCCATGG + Intergenic
1162167583 19:8765018-8765040 TGGGCAGGGGCTCCAGGCCATGG + Intergenic
1162791462 19:13065204-13065226 TGGACACAGGCTCCAGACCAAGG + Intronic
1163236766 19:16034439-16034461 ACACCATTGGCTGCAGGCCAGGG - Intergenic
1164671987 19:30077543-30077565 TGGCCACAGGTGCCAGGCCAGGG + Intergenic
1164692710 19:30222822-30222844 GGCCCATGGCCTCCAGGCCAGGG - Intergenic
1165070295 19:33251556-33251578 CCACCATCTGCTCCAGGCCATGG + Intergenic
1165129151 19:33621616-33621638 TGACGCTAGGCTCCAGACCGCGG - Intergenic
926171113 2:10553098-10553120 GGTCCACAGCCTCCAGGCCAGGG - Intergenic
926579159 2:14615829-14615851 TACCCATATGTTCCAGGCCATGG - Intergenic
929037363 2:37707135-37707157 TGTTCATTAGCTCCAGGCCAGGG + Intronic
929549635 2:42881244-42881266 TGTCCATGGGCTGCAGGCCAAGG - Intergenic
929617175 2:43320728-43320750 TGACCATATGATGGAGGCCAAGG + Intronic
929996621 2:46830054-46830076 TGGCCAAAGGCCCCAGGCCAGGG - Intronic
930377344 2:50584425-50584447 TGACCACAGTTTCCAAGCCAAGG - Intronic
937368331 2:121281093-121281115 TGGCCAGAGGCCCCGGGCCAGGG - Intronic
941958359 2:171228216-171228238 TGAGAATAGGCTGTAGGCCAGGG + Intronic
942214805 2:173708256-173708278 TGAGCATAGACTCCAGGAGATGG - Intergenic
946143431 2:217711279-217711301 TCACCAGAGGCTCCCTGCCATGG + Intronic
948672083 2:239575151-239575173 TGACCCCAGGCACCAGGACATGG + Intergenic
1169124966 20:3121028-3121050 TGACCAGAGGCTTCAAGCCCAGG + Intronic
1171432396 20:25091328-25091350 TGACCATAAGCTCCAGAGCAGGG + Intergenic
1173854509 20:46241420-46241442 TGAGGAAAGACTCCAGGCCAGGG - Intronic
1175538663 20:59734149-59734171 AGACCATAAGCTCCAGCCTAAGG + Intronic
1181312905 22:21955123-21955145 TCCCTATGGGCTCCAGGCCAAGG + Intergenic
1181346013 22:22221195-22221217 TCCCTATGGGCTCCAGGCCAAGG + Intergenic
1181593135 22:23896719-23896741 TGACCCCAGGATCCAGGGCATGG + Intronic
1181620307 22:24086503-24086525 TGATCCTGGGCTCCAGGCCTTGG + Intronic
1182483145 22:30622719-30622741 TGACCATGGCCTCCAGGAAAGGG - Intronic
1183077055 22:35433810-35433832 TCACCACAGGCTCCAGTCCCCGG - Intergenic
1183180267 22:36255205-36255227 TCAGCAGAGGCTCCAGGTCAGGG + Intronic
1183677287 22:39306730-39306752 TGTCCATAGGCCCTGGGCCATGG + Intergenic
949875414 3:8623383-8623405 TGACCTAAGGCCCCAGGGCATGG - Intronic
950046249 3:9950098-9950120 AGACCATGGCCTCCAGCCCATGG - Exonic
953500306 3:43426617-43426639 TGTCCTTGTGCTCCAGGCCACGG + Intronic
954875344 3:53799601-53799623 TGCACACAGGCTACAGGCCAGGG + Intronic
955420738 3:58734636-58734658 GGACCATAGGCACCTGCCCAGGG - Intronic
956310712 3:67876355-67876377 TGGCCATGGGACCCAGGCCAGGG + Intergenic
956662277 3:71610971-71610993 TGTCCACAGGAACCAGGCCAAGG + Intergenic
956915433 3:73866255-73866277 TAACCATCGGCTCCAGTCCCAGG + Intergenic
962284770 3:134076501-134076523 AGACCACAGGCTCCAGGACCGGG + Intronic
963339860 3:144020815-144020837 TAACAATAAGGTCCAGGCCAAGG - Intronic
963458466 3:145576828-145576850 CCACCACAGGCCCCAGGCCATGG - Intergenic
964298405 3:155259664-155259686 TGAATATATGCTCCAGGCCATGG - Intergenic
964347624 3:155770266-155770288 TGAGCACAGGGTCCAGACCAGGG + Intronic
966770987 3:183503235-183503257 GGAGCAGAGGCTCCAGCCCAAGG - Intronic
966974397 3:185071660-185071682 TGATCAGAGGCTCCATCCCAGGG + Intergenic
968802194 4:2750561-2750583 GGACCATGGGCTCGAGGTCAAGG + Intronic
969622079 4:8283726-8283748 TCACCAGAGGCCGCAGGCCAGGG + Intronic
971381373 4:26101580-26101602 TGGGCCTAGGCTCCAGGCCCAGG + Intergenic
972364960 4:38365927-38365949 TGACACTTGGCTCCATGCCATGG + Intergenic
974781170 4:66555524-66555546 TGACCATTAGCTCCAGGGGAAGG + Intergenic
979909465 4:126343668-126343690 GGACTATAGACTCCAGGCAAAGG - Intergenic
980973955 4:139593001-139593023 TGAAGATGGGCTCCAGGGCATGG - Intronic
985563719 5:604718-604740 TGACCAGAGGCTCAAGGAGAAGG + Intergenic
986032734 5:3909149-3909171 TCACCATGGCCACCAGGCCATGG - Intergenic
995588570 5:113674562-113674584 TGTCCAGAGGCTCCCAGCCAGGG - Intergenic
998167061 5:139850174-139850196 TGAGCATCAGCTCCATGCCAGGG + Intronic
1000608406 5:163349081-163349103 TTCCCATAGGCTTCTGGCCATGG + Intergenic
1002954183 6:1845980-1846002 GGATCATATGCTTCAGGCCAAGG - Intronic
1014670651 6:124300662-124300684 GGACCATAAGGTCCAGGCCGAGG + Intronic
1014827789 6:126066174-126066196 TGACCTCTGCCTCCAGGCCAGGG + Intergenic
1015635425 6:135269820-135269842 CCACCCTGGGCTCCAGGCCAGGG + Intergenic
1016757163 6:147699180-147699202 TGACCATAGGCTCCTTGACTTGG + Intronic
1018131785 6:160738725-160738747 TGACACTAGGGACCAGGCCAGGG + Intronic
1020999187 7:15306526-15306548 TGAAATTGGGCTCCAGGCCAAGG - Intronic
1022327562 7:29345809-29345831 TGACCACAGGCTCCAGCCCAAGG + Intronic
1023976428 7:45033714-45033736 TTTCCATAACCTCCAGGCCAGGG + Intronic
1024132148 7:46364041-46364063 TGACCATAGGCACCCTGGCAGGG - Intergenic
1024523819 7:50330948-50330970 TTGCCAGAAGCTCCAGGCCAGGG - Intronic
1025208627 7:57008163-57008185 TGACCCCAGGCCCCAGGACAGGG - Intergenic
1025663320 7:63568715-63568737 TGACCCCAGGCCCCAGGACAGGG + Intergenic
1026340301 7:69428894-69428916 TGTCCATATCCTCCATGCCAGGG + Intergenic
1026658698 7:72279606-72279628 TGACTGGAGGCTCCAGGCTACGG + Intronic
1026881564 7:73909630-73909652 TGAGCAAAGGCTGCAGACCAAGG + Intergenic
1031173884 7:118324911-118324933 TGAGCATGAGATCCAGGCCAGGG - Intergenic
1032076443 7:128838365-128838387 TGCCCACAGGTTCCAGGCCAGGG - Exonic
1039574316 8:38611315-38611337 TGACCAATGGCTCAAGGCCTGGG + Intergenic
1047194772 8:122711688-122711710 GGACAATAAGGTCCAGGCCAAGG + Intergenic
1049437680 8:142595241-142595263 AGACCACAAGCTCCAGGGCAGGG + Intergenic
1049756369 8:144312872-144312894 TGACCACAGGCCCGTGGCCAGGG - Intronic
1049787966 8:144460212-144460234 TGAACAGAGCCCCCAGGCCAGGG + Intronic
1052784504 9:32815998-32816020 TGAACATGGGCTCCAGGCTGTGG + Intergenic
1053130901 9:35615140-35615162 TGACCATCAGTTCCATGCCAGGG - Intronic
1055010433 9:71559440-71559462 TGACCCTTGGCTCCTGGCTATGG - Intergenic
1056591305 9:87968056-87968078 GGACATGAGGCTCCAGGCCAGGG + Intronic
1057560605 9:96125296-96125318 TGCCCAGCGACTCCAGGCCAAGG - Intergenic
1060809791 9:126605022-126605044 AGACCATAGTCTGGAGGCCAAGG - Intergenic
1061237417 9:129351098-129351120 TGGCCTCAGCCTCCAGGCCAGGG + Intergenic
1061550929 9:131334282-131334304 GGACCCCAGCCTCCAGGCCAGGG + Intergenic
1062139156 9:134945846-134945868 TGGCCCCAGGCTCCGGGCCAGGG - Intergenic
1062331801 9:136048169-136048191 TGTCCATGGGCTCCAGTCCCAGG - Intronic
1062359972 9:136183039-136183061 TGGGCACAGGCTCCAGCCCAGGG - Intergenic
1185783221 X:2867113-2867135 TGAGCATGAGCTCAAGGCCAAGG + Intronic
1186925850 X:14332536-14332558 TGACCATAAGCTCAAGTCAATGG + Intergenic
1189289799 X:39877027-39877049 GGACAATAGGTTCCAGGGCAAGG + Intergenic
1194472278 X:94311352-94311374 TGACCAAAGCCTCCAGAGCAAGG + Intergenic
1196890869 X:120289402-120289424 TGATCATTGGCTCCAGTCAAAGG - Intronic
1197670597 X:129273125-129273147 TTACCATGGGCTTCAGGCCTTGG - Intergenic
1198196804 X:134371663-134371685 TGACCATGAGCTCAAGGGCAGGG + Intergenic