ID: 1141579105

View in Genome Browser
Species Human (GRCh38)
Location 16:84985101-84985123
Sequence GACCATAGGCTCCAGGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141579100_1141579105 0 Left 1141579100 16:84985078-84985100 CCCACTCATCTTCTTGTGGGACT 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1141579105 16:84985101-84985123 GACCATAGGCTCCAGGCCATGGG 0: 1
1: 0
2: 1
3: 10
4: 125
1141579101_1141579105 -1 Left 1141579101 16:84985079-84985101 CCACTCATCTTCTTGTGGGACTG No data
Right 1141579105 16:84985101-84985123 GACCATAGGCTCCAGGCCATGGG 0: 1
1: 0
2: 1
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141579105 Original CRISPR GACCATAGGCTCCAGGCCAT GGG Intronic
901533469 1:9867689-9867711 ACCCACAGGCTCCAGGCCTTTGG + Intronic
902845085 1:19104051-19104073 TGCCTTAGGCTCCAGGCCACTGG + Intronic
904330958 1:29757555-29757577 GACCAGAGGCTCCAGGGCAAAGG + Intergenic
904378096 1:30094408-30094430 GGCCATAGGAGCCAGTCCATAGG + Intergenic
904415718 1:30360037-30360059 GACCAGAGGCTCCAGGGCAAAGG - Intergenic
906697326 1:47831966-47831988 AAACATAAGCTCCAGACCATAGG - Intronic
907267910 1:53274049-53274071 GAACAGAGGCTCCAGGCTGTAGG - Intronic
915669874 1:157479231-157479253 GCCCAAAGGCCCCAGGCCCTAGG - Intergenic
923687133 1:236161163-236161185 GAGCAAAGGCTGCAGACCATGGG - Intronic
1063420685 10:5910607-5910629 CACCCTACTCTCCAGGCCATGGG - Intronic
1064089045 10:12367863-12367885 GTCCACAGCCCCCAGGCCATGGG - Intronic
1070673672 10:78397224-78397246 GACAGTAGGCACCAGGCCCTGGG + Intergenic
1072615991 10:97049220-97049242 GACCCTAGGCTCCAGGCCACAGG - Intronic
1076143603 10:128098695-128098717 GACCAAATGCCCCCGGCCATTGG + Exonic
1078356457 11:10635529-10635551 TGCCAGAGGCTCCAGCCCATTGG - Intronic
1079979994 11:27140932-27140954 GGCCATAGGGTCCAGGGCACAGG - Intergenic
1081998157 11:47377772-47377794 GACCAAAGGGTCAGGGCCATGGG - Intronic
1081998765 11:47380843-47380865 CTCCAAAGGCTCCAGGCCACAGG + Intergenic
1084198731 11:67541374-67541396 GGCCACAGGCTGCAGGCCCTGGG - Intergenic
1089347119 11:117797442-117797464 GACCACAGGCTCCAAGCCGGTGG - Intronic
1089401772 11:118168518-118168540 GACCAGGGGCTTCATGCCATGGG + Intronic
1099925093 12:89007533-89007555 GAACATAGGCTCTGGGCCAGGGG - Intergenic
1100311362 12:93397807-93397829 GAGCTTCTGCTCCAGGCCATGGG + Intronic
1113988092 13:114335355-114335377 GTCAATAGGCTCCAGGAAATGGG - Intergenic
1114200760 14:20517927-20517949 GAGCATAGCCTCCAGCCTATGGG + Intergenic
1116898334 14:50338556-50338578 GCCCATGGTCTCCAGACCATGGG - Intronic
1118685731 14:68289140-68289162 TGCCATAGGCTCCAGGCAGTTGG - Intronic
1119830995 14:77702481-77702503 TACCATAGAGTCCTGGCCATTGG + Intronic
1122117782 14:99536270-99536292 GGCCAAAGGCTTCCGGCCATAGG + Intronic
1125277930 15:38013041-38013063 GTCCATAGTCTGCAGGCCAAGGG + Intergenic
1126062502 15:44796422-44796444 GCCCATTGGATCCTGGCCATGGG - Intergenic
1127152309 15:56089072-56089094 GACCACATGCTCCAGGAAATGGG + Exonic
1127630296 15:60821377-60821399 GACCACAGGCGCCAGGACACGGG - Intronic
1128645698 15:69377320-69377342 GATCAAAGGCTGAAGGCCATTGG + Intronic
1128682117 15:69659870-69659892 GACCATAAGGGCCAGGCCAATGG - Intergenic
1129114989 15:73360389-73360411 AAACAAAGGCTCCAGGCCAGCGG + Intronic
1135995282 16:27243435-27243457 GGCCATTGGCTGCAGCCCATTGG - Intronic
1136716748 16:32288233-32288255 GACCATGGGCTCCAGCTCATAGG + Intergenic
1136835124 16:33494478-33494500 GACCATGGGCTCCAGCTCATAGG + Intergenic
1141579105 16:84985101-84985123 GACCATAGGCTCCAGGCCATGGG + Intronic
1142184279 16:88686983-88687005 GACCACTGTCTCCAGGCCACCGG - Intergenic
1142236430 16:88924656-88924678 GACCTCATGCTCCCGGCCATGGG - Intronic
1203009679 16_KI270728v1_random:229554-229576 GACCATGGGCTCCAGCTCATAGG - Intergenic
1203145297 16_KI270728v1_random:1794799-1794821 GACCATGGGCTCCAGCTCATAGG + Intergenic
1142471184 17:164187-164209 GTCCATTGGCTTCAGGCCCTGGG + Exonic
1142672305 17:1492800-1492822 GACCCTGGGCTCCAGGTCAAAGG + Exonic
1143591783 17:7889387-7889409 GAGACCAGGCTCCAGGCCATGGG - Intronic
1146184595 17:30716794-30716816 GACCACAGGCCACAGGCCACAGG + Intergenic
1146949333 17:36894790-36894812 GGCCCCAGGCTCCAGGCCAGAGG - Intergenic
1148160028 17:45444437-45444459 CACCAAAGGCCCCAGGCCCTGGG + Intronic
1148861047 17:50604496-50604518 GCCGAGAGGCTTCAGGCCATGGG + Intronic
1150391319 17:64791316-64791338 CACCAAAGGCCCCAGGCCCTGGG + Intergenic
1150410102 17:64935360-64935382 CACCAAAGGCCCCAGGCCCTGGG + Intergenic
1151312882 17:73304992-73305014 AACCACAGGCTTCAGGCCAGGGG + Intronic
1152788950 17:82267844-82267866 AGCCATCGGCCCCAGGCCATGGG - Intronic
1153761926 18:8339816-8339838 GAACATACCCTCCAGGCCAGGGG - Intronic
1157259080 18:46163166-46163188 GTGCAAAGGCACCAGGCCATGGG - Intergenic
1160715195 19:573173-573195 GACCCCTGGCTCCAGGCCAAAGG - Intronic
1161285169 19:3464773-3464795 GACCAAGGGCTCGAGGCCAGAGG - Intronic
1162924067 19:13920861-13920883 CAGCATAGGCTCCAGTCCCTTGG - Exonic
1163111162 19:15161499-15161521 GAGCAGAGGCCCCAGGCCGTGGG + Exonic
1164692709 19:30222821-30222843 GCCCATGGCCTCCAGGCCAGGGG - Intergenic
1165977348 19:39688271-39688293 AACCATAGGCCATAGGCCATAGG + Intergenic
1166552716 19:43677104-43677126 ACCCATAGGCTCCAGGGCTTAGG - Intergenic
924959731 2:23457-23479 GTCAATAGGCTCCAGGTAATGGG + Intergenic
926171112 2:10553097-10553119 GTCCACAGCCTCCAGGCCAGGGG - Intergenic
928742619 2:34372891-34372913 GACCACAAGCTCCAGGCCACAGG - Intergenic
929225923 2:39511526-39511548 GACCAGAGGACCCAGGCCACTGG - Intergenic
932469594 2:71945183-71945205 GACCCCAGGCTCCTGGCCCTGGG - Intergenic
942214804 2:173708255-173708277 GAGCATAGACTCCAGGAGATGGG - Intergenic
944834740 2:203567806-203567828 GAGCATTAGCTCCAGCCCATAGG - Intergenic
946143432 2:217711280-217711302 CACCAGAGGCTCCCTGCCATGGG + Intronic
946163239 2:217848480-217848502 GACCATAGGCTCCATGGGGTAGG + Exonic
946195048 2:218027850-218027872 ACCCAGAGGCTCCAGGCCAGAGG + Intergenic
947588050 2:231369190-231369212 GACCCAAGGCTCCATGGCATGGG + Intronic
947737930 2:232467333-232467355 GGGCAAAGGCTCCATGCCATGGG - Intergenic
948708275 2:239809333-239809355 GACCCTGGGCTCCAGGACACAGG - Intergenic
1169796810 20:9471690-9471712 GACAATAAGCTCCATTCCATAGG + Intronic
1172772457 20:37389510-37389532 GACCATGTGCTCCAGGTCTTGGG + Intronic
1173360285 20:42338030-42338052 GCCCATAGGCTCCAGGCAGATGG - Intronic
1174513796 20:51075786-51075808 GACCATAGGCTTCATGACACAGG + Intergenic
1175197582 20:57255089-57255111 GACCACAGAGTCAAGGCCATGGG + Intronic
1175538664 20:59734150-59734172 GACCATAAGCTCCAGCCTAAGGG + Intronic
1183677288 22:39306731-39306753 GTCCATAGGCCCTGGGCCATGGG + Intergenic
1185049893 22:48548544-48548566 GACCCCAGGCTCCAGGCTCTGGG + Intronic
950046248 3:9950097-9950119 GACCATGGCCTCCAGCCCATGGG - Exonic
951597761 3:24336301-24336323 GACAATAGGCCAGAGGCCATGGG + Intronic
953527669 3:43707489-43707511 TCCCATTGGCTCCAAGCCATTGG - Intronic
955326779 3:58014660-58014682 GCCTAAAGGCTCCAGGCCCTGGG - Intronic
961102704 3:124215136-124215158 GACCATAGCCCCCTGGCCACAGG + Intronic
962430179 3:135311861-135311883 GGCCATAGGCAGCAGGCCCTCGG - Intergenic
964298404 3:155259663-155259685 GAATATATGCTCCAGGCCATGGG - Intergenic
965542010 3:169880137-169880159 GACCAGAGGCACCAGGCAGTGGG - Intergenic
967854712 3:194107914-194107936 GAGAATAGGCTCAAGACCATTGG - Intergenic
968375364 4:35890-35912 GTCAATAGGCTCCAGGAAATGGG + Intergenic
983063480 4:163184090-163184112 GCCCAGAGGCTCCAGGAGATTGG - Intergenic
984918697 4:184745222-184745244 GACCAGAGGCTTCAGGACACTGG + Intergenic
985469409 5:29464-29486 GTCAATAGGCTCCAGGAAATGGG + Intergenic
985940495 5:3132014-3132036 CCCCATGGGCTCCAGGGCATTGG - Intergenic
986032733 5:3909148-3909170 CACCATGGCCACCAGGCCATGGG - Intergenic
986304548 5:6505733-6505755 GTCCAGAGGCTGCTGGCCATGGG - Intergenic
988151818 5:27392895-27392917 TAGAATTGGCTCCAGGCCATTGG + Intergenic
997282851 5:132659500-132659522 GGGCAGAGGCTCCAGGCCTTGGG + Intronic
998162103 5:139819276-139819298 GATAATAGGGTCCAGGCCCTCGG + Intronic
1002074909 5:176702647-176702669 GTCCATAGGCTTCAGGCCACAGG - Intergenic
1002810210 6:621115-621137 GAGAGTGGGCTCCAGGCCATTGG - Intronic
1006022516 6:31125806-31125828 GACCGTGGGCTCCATGCCAGTGG + Exonic
1006260276 6:32862244-32862266 AATAATTGGCTCCAGGCCATAGG + Intergenic
1006914537 6:37585830-37585852 GACCCCAGGCTCCAGGGCAGTGG - Intergenic
1010579477 6:77576486-77576508 GTCCATAGGCTCCTGTCCTTGGG + Intergenic
1013366523 6:109441638-109441660 GACAACAGGCTTCAGGCCAGTGG - Intronic
1014136295 6:117894031-117894053 GAACATAGGGTCCAGAGCATGGG + Intergenic
1014244854 6:119057205-119057227 GACCATAATTTCAAGGCCATTGG - Intronic
1015635426 6:135269821-135269843 CACCCTGGGCTCCAGGCCAGGGG + Intergenic
1016603736 6:145893242-145893264 GCCCATGAGCTTCAGGCCATAGG - Exonic
1017413891 6:154199336-154199358 CACCACAGGCTCCAGCGCATGGG + Intronic
1019164591 6:170089669-170089691 GCCCATGGGCTCCTGGCCGTGGG - Intergenic
1019670429 7:2275047-2275069 GACCACAGGGTCCAGGAGATGGG + Intronic
1020107052 7:5427026-5427048 GGCCATAGGGCACAGGCCATAGG + Intergenic
1027532014 7:79346739-79346761 GAACATGGGATCCCGGCCATAGG - Intronic
1033013210 7:137644355-137644377 CACCTTAGCCTCCAGGGCATAGG - Intronic
1035564633 8:633201-633223 GAACAGAGTCGCCAGGCCATAGG - Intronic
1038535892 8:28352539-28352561 GACCCTAGGCTAGAGGCCCTGGG + Intronic
1040389642 8:46938847-46938869 GACCATGGTCACCAGGCTATGGG + Intergenic
1041408786 8:57530639-57530661 GCCCTTAAGCCCCAGGCCATGGG - Intergenic
1049437681 8:142595242-142595264 GACCACAAGCTCCAGGGCAGGGG + Intergenic
1050955400 9:11651587-11651609 GACCATAAACTATAGGCCATGGG + Intergenic
1060809790 9:126605021-126605043 GACCATAGTCTGGAGGCCAAGGG - Intergenic
1060862012 9:126962273-126962295 GTACATAGTCTCCAGGCCACAGG - Exonic
1203573862 Un_KI270744v1:158254-158276 GTCAATAGGCTCCAGGAAATGGG - Intergenic
1185461070 X:333012-333034 GACCATGGGCTCCGGCTCATAGG + Intergenic
1186282989 X:8014385-8014407 GACCATAGGATCCAGCACAGTGG + Intergenic
1189289800 X:39877028-39877050 GACAATAGGTTCCAGGGCAAGGG + Intergenic
1194568878 X:95528271-95528293 GAGAAAAGTCTCCAGGCCATTGG + Intergenic
1197616601 X:128698922-128698944 GACTCTAGGCTCCAGGTCAGTGG + Intergenic
1197670596 X:129273124-129273146 TACCATGGGCTTCAGGCCTTGGG - Intergenic
1200605296 Y:5256121-5256143 GAAGATATGCTCCAGGACATTGG - Intronic