ID: 1141579108

View in Genome Browser
Species Human (GRCh38)
Location 16:84985112-84985134
Sequence CCAGGCCATGGGATGCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141579101_1141579108 10 Left 1141579101 16:84985079-84985101 CCACTCATCTTCTTGTGGGACTG No data
Right 1141579108 16:84985112-84985134 CCAGGCCATGGGATGCCTTCAGG 0: 1
1: 0
2: 3
3: 26
4: 241
1141579100_1141579108 11 Left 1141579100 16:84985078-84985100 CCCACTCATCTTCTTGTGGGACT 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1141579108 16:84985112-84985134 CCAGGCCATGGGATGCCTTCAGG 0: 1
1: 0
2: 3
3: 26
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141579108 Original CRISPR CCAGGCCATGGGATGCCTTC AGG Intronic
900255695 1:1697394-1697416 CCAGGGCATGGGCTGCCTTCAGG - Intronic
900264365 1:1750017-1750039 CCAGGGCATGGGCTGCCTTCAGG - Intergenic
901069293 1:6509267-6509289 CCAGGCCAGGGGATGCTCACTGG - Intronic
901391568 1:8949469-8949491 CCAGTCCATGGGCAGCCTGCAGG + Intronic
902414335 1:16230151-16230173 TCAGGCCTGGGGCTGCCTTCAGG + Intergenic
903741747 1:25562494-25562516 CCAGGCTCTGGAATGCCTGCTGG - Intronic
904529462 1:31158739-31158761 CCAGGCTTTGGGAGGCCTACAGG + Intergenic
907294260 1:53439491-53439513 CCAGGCGAGGGGATCCCTGCGGG + Intergenic
907525467 1:55051398-55051420 CCAGGCCAAAGGAAGACTTCAGG - Intronic
907730414 1:57060506-57060528 CCAGGCCATGGGCTTGCATCTGG + Intronic
910560234 1:88582178-88582200 CAAGGCAATGGGTTCCCTTCTGG - Intergenic
912286040 1:108370393-108370415 CCAGGCCACGGGATGCTCCCTGG + Intergenic
915661036 1:157405243-157405265 ACAGGCCAGGGGATGCCTTAAGG - Intergenic
916432267 1:164742307-164742329 CGAGGCCATTGGATCCCTTGAGG + Intronic
916990991 1:170245101-170245123 TCAGGACATGTGATGCCTCCAGG - Intergenic
917626486 1:176851576-176851598 CTAGGCCATTTGATGCCTTTTGG + Intergenic
918143996 1:181739996-181740018 CTAGGAAATGGGATGCTTTCAGG + Intronic
918585774 1:186186711-186186733 CCAGGCCATGAGATGTTCTCAGG + Intronic
918825337 1:189316650-189316672 CCAGGCCATGGGTTGTTTTTTGG - Intergenic
919304006 1:195806743-195806765 ACAGGCCAAGGGATGCCAGCAGG + Intergenic
921607012 1:217167589-217167611 CCAGGCAATGGAGGGCCTTCTGG - Intergenic
922498906 1:226082934-226082956 CCCGGGCATGGCATGCCTTGAGG - Intergenic
923005748 1:230048322-230048344 CCAGGCCCTGGGATGATTTAAGG - Intergenic
923534369 1:234837826-234837848 CCAAGCCATGGGAACCCATCTGG - Intergenic
924202062 1:241670828-241670850 CCAGGGCAGGGGATGCTTTCGGG - Intronic
924423304 1:243929392-243929414 CCATGCCATGGTGTGCCTTGCGG + Intergenic
924941541 1:248815679-248815701 CCTGGCCCTGGGATGACTTAGGG - Intronic
1064257422 10:13755243-13755265 CCAGGCCAGAGGGTGCCTTTTGG - Intronic
1067853116 10:49768293-49768315 CCAGGCCATCGCTTGCCCTCGGG + Intergenic
1070779827 10:79131061-79131083 CATTGCCATGGAATGCCTTCAGG + Intronic
1071491626 10:86140285-86140307 CCATGCCCTGGGATGCCCACAGG + Intronic
1072695775 10:97601793-97601815 CCAGGGCTTGGGATGCCTGGAGG + Intronic
1074684646 10:115949565-115949587 CCAGCACCTGGGATACCTTCTGG + Intergenic
1075090101 10:119439365-119439387 CCAGGCCCTGTTCTGCCTTCAGG + Intronic
1075928470 10:126272764-126272786 CCAGGCCATGTGCTGCCTCCAGG + Intronic
1077466369 11:2735520-2735542 CCAGGCCCTAGGATGCCTGCGGG - Intronic
1081507803 11:43736208-43736230 CAAGGCCCTGCGATTCCTTCTGG - Intronic
1081871949 11:46387023-46387045 CCAGGCCTTGCGCTGCCTCCAGG - Intergenic
1082101676 11:48178012-48178034 CCAGGCCATGTGCTGGCCTCCGG - Intergenic
1082795718 11:57376588-57376610 CCACGCCCGGGGAGGCCTTCCGG + Intergenic
1083742538 11:64718459-64718481 CCTGTCCACGGGCTGCCTTCTGG - Intronic
1083887924 11:65581695-65581717 CCAGGCCCAGGCATGCCCTCAGG + Exonic
1085262953 11:75218794-75218816 CCAGGTCCTGGCATTCCTTCCGG + Intergenic
1085280413 11:75326269-75326291 CCAGGCCCTGGGCTGCTTTCTGG - Intronic
1085525363 11:77160637-77160659 CCAGGCCCTGGGCTGGGTTCGGG + Intronic
1086520830 11:87666074-87666096 CCAGGCCATAGGATGGATGCTGG + Intergenic
1089280921 11:117373810-117373832 CCAGGCCATGGAAGGACTTGGGG - Exonic
1090116640 11:123980108-123980130 CCAGGCCAAGGGGTGCCTGCAGG + Intergenic
1090570129 11:128036733-128036755 CCAGGGAATGTGATGACTTCTGG + Intergenic
1091049871 11:132357671-132357693 CCAGGCCAAGGCATGTCATCAGG + Intergenic
1091740582 12:2958683-2958705 GCATGCCATGGGACGCCTTCTGG - Intergenic
1092869065 12:12789459-12789481 CCAGGTCAAGTGATACCTTCTGG - Exonic
1096868316 12:54578149-54578171 CAAGGCCCTGGGAAGCCTCCAGG - Exonic
1098600798 12:72329829-72329851 CCAGGATAAGGGATTCCTTCTGG - Intronic
1101726798 12:107394847-107394869 GCAGGCCAGGGGATTCCCTCAGG + Intronic
1102266642 12:111491646-111491668 CAAGGCAATGGGTTCCCTTCTGG - Intronic
1102506048 12:113385114-113385136 CCAGGCAATGGGGAGCCATCGGG + Intronic
1102509178 12:113402725-113402747 CGGTGCCATGGGATGCCTTCAGG + Intronic
1104357607 12:128101561-128101583 CCAAGGCATGGGGTGCTTTCTGG + Intergenic
1104778109 12:131403155-131403177 CCTGGCCACGGGCTGCCTTCGGG - Intergenic
1104877361 12:132044962-132044984 CCAGGTCATGTGACGCCCTCGGG - Intronic
1105607125 13:21935233-21935255 CCTGGCCTCGGGATGCCTTTTGG + Intergenic
1107866916 13:44712148-44712170 CCAAATCATGGGATGCCCTCAGG + Intergenic
1108505423 13:51108398-51108420 CCAGGGCAAAGGATTCCTTCTGG + Intergenic
1110184489 13:72657096-72657118 GCGGGTCATGGAATGCCTTCTGG - Intergenic
1110326689 13:74224282-74224304 GCAGGCCCTGGGCTACCTTCTGG + Intergenic
1111085842 13:83374115-83374137 CAAGGCAATGGGCTCCCTTCAGG + Intergenic
1112192338 13:97190178-97190200 CGAGGGCATGGGTTGCTTTCAGG - Intergenic
1113993891 14:16051640-16051662 CGAGGCCATAGGATCCCTTGAGG + Intergenic
1114737720 14:25059747-25059769 CCAGGTCATGCAGTGCCTTCAGG + Intergenic
1115433597 14:33348707-33348729 CCAGGCCTTGGCATGGCTCCTGG - Intronic
1116173194 14:41429281-41429303 TCAGGTAATGTGATGCCTTCAGG - Intergenic
1116220913 14:42085890-42085912 CAAGGCAATGGGCTCCCTTCTGG + Intergenic
1121322962 14:93003261-93003283 CCAGGCCAAGCAATGCTTTCTGG + Intronic
1122296594 14:100709421-100709443 CCAGGCCAGGGGAGGCCTGGGGG - Intergenic
1122354386 14:101114336-101114358 CCTGGCCATTGGCTTCCTTCTGG + Intergenic
1122570787 14:102698653-102698675 CCAGGTCATGAGATGCACTCAGG - Intronic
1123756513 15:23401280-23401302 ACAGGCCATGGAATGCTTACTGG + Intergenic
1126790820 15:52219512-52219534 CCAGGCAGTTGGTTGCCTTCAGG - Intronic
1127731905 15:61809410-61809432 CCAGGCATTGGGCTGCATTCTGG - Intergenic
1129376719 15:75138323-75138345 CCAGCCCCTGGGAGGCCTCCTGG + Intergenic
1132230674 15:100181562-100181584 CAAGGCAATGGGTTTCCTTCTGG + Intronic
1134034197 16:11017019-11017041 CCATGCCAAGGGGTGCCTGCAGG + Intronic
1134839125 16:17387343-17387365 CCAGGCAATGGGAAGCTCTCAGG - Intronic
1135464964 16:22677155-22677177 CCAGGCCTTGGCATTCCTCCTGG + Intergenic
1135465071 16:22677770-22677792 GCAGGTCAGGGGATGCCTTGAGG + Intergenic
1136098715 16:27977602-27977624 TCTGGCCATAGAATGCCTTCTGG - Intronic
1136608974 16:31354942-31354964 CAAGGTCAAGGGGTGCCTTCTGG + Intergenic
1137272159 16:46908972-46908994 CCAGGCCATGGGATTCCTTTGGG - Intronic
1137408848 16:48211011-48211033 CCAGGCCTAGAGATGCCCTCGGG - Exonic
1138426730 16:56939249-56939271 CCAGGCCTTGGAATGCCTGCTGG - Exonic
1138916579 16:61471806-61471828 CAGGGCAATGGGTTGCCTTCTGG - Intergenic
1141171131 16:81692455-81692477 CCAGGCCCTGAAATGCCTCCAGG + Intronic
1141579108 16:84985112-84985134 CCAGGCCATGGGATGCCTTCAGG + Intronic
1142127574 16:88417808-88417830 CCAGGCCATGGGGGGCTTTGGGG - Intergenic
1142665969 17:1464125-1464147 CGAGGCCCTTGGTTGCCTTCCGG + Exonic
1143410517 17:6705650-6705672 CCCGGGCATGGGTTGCCTGCAGG + Intronic
1145784927 17:27587620-27587642 CCAGCCCATGGGTGGGCTTCGGG - Intronic
1147553481 17:41461638-41461660 CCAGGCAATGGCATGCCCTCAGG - Intronic
1147722351 17:42547006-42547028 CCGGGCCCTGGCATGCCCTCAGG + Intergenic
1147723539 17:42553176-42553198 CCGGGCCCTGGCATGCCCTCCGG + Exonic
1149153195 17:53594377-53594399 CAAGGCAATGGGTTCCCTTCTGG + Intergenic
1150913447 17:69412517-69412539 CCAGGCCCTGGGATAGCTGCTGG - Intergenic
1151519017 17:74615211-74615233 CCGGACCATGGGATGCTTTTGGG + Intronic
1151836813 17:76587224-76587246 CCAGGCCCTGGGAGGTTTTCGGG - Intergenic
1155792835 18:29996038-29996060 CAAGGCTATGGGATCCCTTCTGG - Intergenic
1156460594 18:37319420-37319442 CTGGGGCATGGGATCCCTTCAGG + Intronic
1157114993 18:44854154-44854176 CCAGGCCTTGTGATGCATTCTGG - Intronic
1159284897 18:66336567-66336589 CAGGGCCATGGGCTCCCTTCTGG + Intergenic
1159284959 18:66336927-66336949 CAAGGCAATGGGTTCCCTTCTGG + Intergenic
1160199735 18:76786720-76786742 CGAGGCAATAGGATGCCTTGAGG + Intergenic
1161440814 19:4290680-4290702 CTAGGCCATGGGAGGGCTTTGGG - Exonic
1161469491 19:4449192-4449214 CCAGGCCATGGGTGGCTCTCTGG - Intronic
1161599823 19:5174785-5174807 CCAGGCCCTGGCCTGCCCTCTGG - Intronic
1162086383 19:8251837-8251859 AGAGGCCCTGGGATGCCTTTGGG - Intronic
1162679848 19:12332806-12332828 GGAGGCCATGGGAAGCCTGCAGG - Intronic
1163223038 19:15935350-15935372 CCAGGCCCTGGGTTGCCTGGAGG - Intergenic
1164216152 19:23150910-23150932 TCAGGTAATGGGAAGCCTTCAGG - Intergenic
927107924 2:19843777-19843799 CCAGCCCATGGGTTGACATCTGG + Intergenic
927202647 2:20587997-20588019 CCAGGACATGGGACACCTTGGGG + Intronic
928682736 2:33718945-33718967 CCACTCCATGGGATGTCTGCTGG + Intergenic
929432089 2:41895773-41895795 CCAGGACATCTGATGGCTTCTGG + Intergenic
929794449 2:45048096-45048118 ACAGGCCATGGTGTGCCTTGCGG - Intergenic
931196333 2:60055273-60055295 CCAGCCAAGCGGATGCCTTCAGG + Intergenic
931900039 2:66778356-66778378 CCAGGCACTGGGATGCCTGGAGG - Intergenic
932431916 2:71681168-71681190 CCATGCAATGGGATGCCTCCTGG - Intronic
932892556 2:75609545-75609567 CCAGGCCCTGGGATGTTTCCAGG + Intergenic
934893871 2:98095047-98095069 CCAGGTAATGTGATGCCTCCAGG + Intronic
936008712 2:108911161-108911183 CCTGCCCCTGGGATGCTTTCAGG + Intronic
938108270 2:128547842-128547864 CCAGGCCATGTCATCCCTCCTGG - Intergenic
938770111 2:134494527-134494549 ACAGTCCATGAAATGCCTTCAGG - Intronic
942040964 2:172062389-172062411 CCAGGCCAGGGGATACATCCTGG - Intronic
945269659 2:207925351-207925373 CCAGGCTCTTGGATGCCTCCAGG + Intronic
946509115 2:220335189-220335211 CAAGGCAATGGGTTCCCTTCTGG + Intergenic
946628325 2:221639202-221639224 CCAGGCCATGGCCAGCATTCAGG + Intergenic
946673227 2:222128722-222128744 CCAGGTAAGGGGATGTCTTCTGG + Intergenic
1169145615 20:3250297-3250319 TGAGGCCAGGGGATGCCTCCTGG - Exonic
1169216741 20:3798562-3798584 ACAGACCATGGGGTGGCTTCAGG + Intronic
1172153568 20:32807966-32807988 CAGGGCCTGGGGATGCCTTCAGG - Exonic
1172304409 20:33871094-33871116 CCAGGCCAGGGGCTGCCTCTGGG + Intergenic
1172941411 20:38657041-38657063 CCAAGCCAGGGGATGCCCGCAGG - Intergenic
1173021499 20:39271426-39271448 CCAGGCACTGGGCTGCCCTCAGG - Intergenic
1176106146 20:63388776-63388798 CCAGGCCAATGGATGCCTCCAGG - Intergenic
1176181371 20:63751416-63751438 CCAGGCCCTCGGATGCCGCCTGG - Intronic
1176939968 21:14912092-14912114 CAAGGCAATGGGTTCCCTTCTGG + Intergenic
1179784564 21:43722102-43722124 ACAGGCCATGGGATGCACCCTGG + Intronic
1180023588 21:45145453-45145475 CCAGGCCCTGGGGTGATTTCGGG + Intronic
1180246314 21:46550419-46550441 CCAGGAAATGGAATGCCCTCTGG - Intronic
1180313377 22:11255873-11255895 CGAGGCCATAGGATCCCTTGAGG - Intergenic
1180755446 22:18157785-18157807 CCAGGCCCTGGGACGCTCTCTGG - Exonic
1180980746 22:19876959-19876981 CCTGGCCATGGGCTCCCTCCAGG - Intronic
1181594499 22:23905582-23905604 GCAGGCCATGAGATGTCTCCAGG - Intergenic
1182421064 22:30248810-30248832 CCAGGCCCTTGCATGCCTTCTGG + Intergenic
1183420508 22:37709119-37709141 CCAGGCCAGGGGAGGCCTGGTGG - Intronic
1184544503 22:45157491-45157513 CCAGGCCATGGGATGTGCTGGGG + Intergenic
1185271352 22:49930601-49930623 CCTGGCCATGGGATGCCCCATGG - Intergenic
951629163 3:24699616-24699638 CCAGACCAGGAGATTCCTTCAGG - Intergenic
951819398 3:26791378-26791400 CAAGGCAATGGGTTCCCTTCTGG + Intergenic
951907248 3:27717447-27717469 CCAGGGCATGGGATGTCTGAAGG + Exonic
952963174 3:38605440-38605462 TCTGGTCAAGGGATGCCTTCTGG - Intronic
953447716 3:42981614-42981636 CCAGACCAAGGGATGTTTTCAGG + Intronic
953449265 3:42992496-42992518 CCAGGCCTTGCTATGCCTCCAGG - Intronic
953545374 3:43860462-43860484 CAGGACCATGGCATGCCTTCGGG - Intergenic
953967901 3:47324125-47324147 CCCTGCTGTGGGATGCCTTCTGG + Intronic
954036057 3:47851861-47851883 CCAGGAGATGGAATTCCTTCAGG - Exonic
954756927 3:52845693-52845715 GCAGGCCTTGGAATGCCTCCAGG + Intronic
955158903 3:56445611-56445633 TCAGGCCATGGGAAGCGTTTTGG - Intronic
956256967 3:67293401-67293423 CCAGGCCATGTGATGCTGGCAGG - Intergenic
957915785 3:86686713-86686735 CAAGGCAATGGGTTTCCTTCTGG - Intergenic
958021600 3:88004058-88004080 CCAGGCCATAGGATGCTCACTGG - Intergenic
958682790 3:97353044-97353066 CAAGGCAGTGGGATTCCTTCTGG - Intronic
959409088 3:105997887-105997909 CAAGGCAATGGGTTCCCTTCTGG + Intergenic
960333693 3:116391980-116392002 CCTGCCCATGGGGTGCCTTTGGG - Intronic
960378187 3:116928513-116928535 CCTAGCCAAGGGAAGCCTTCAGG - Intronic
961635117 3:128328404-128328426 CCAGGCCATGGGATGAGGTGTGG + Intronic
961918812 3:130404658-130404680 CCAGGCAATGGGAAGCCATAGGG + Intronic
962830809 3:139137913-139137935 CCAGGACATGGGAAGACTTATGG + Intronic
963051985 3:141150418-141150440 CCAGGTCATGGGGGGACTTCTGG + Intergenic
964075244 3:152684775-152684797 TCATGCCAAGGGATGCCTGCAGG + Intergenic
965026132 3:163303927-163303949 CAAGGCAATGGCATCCCTTCTGG - Intergenic
966214751 3:177490778-177490800 CCAAGGCATGTGATGCCCTCTGG + Intergenic
966313805 3:178623945-178623967 CCAGGTCATAGGATACCTTAAGG + Intronic
966752003 3:183331125-183331147 CCTGGCCCTGGGATGACTTAGGG - Intronic
967113136 3:186312955-186312977 CCAGGCAATGGGCTGCATGCTGG - Intronic
968592510 4:1466082-1466104 CCAGGCCCTGGGAGGCCGTGGGG - Intergenic
968690372 4:1986972-1986994 CCTGGCCCTGGGATGCCTGGTGG + Intronic
969883012 4:10191100-10191122 CCATGCAATGGAATGCTTTCTGG + Intergenic
970584494 4:17502035-17502057 CCAGGCCATGGGATTGCCTGAGG + Intronic
970605914 4:17681773-17681795 CCAGGAAATGGGATGCCATGGGG - Intronic
970808454 4:20063282-20063304 CCAGACAAAGAGATGCCTTCAGG + Intergenic
972106429 4:35494312-35494334 TCAGGCCAAGGGTTGCCTGCAGG - Intergenic
974470924 4:62316534-62316556 CCATGCCATTGAATCCCTTCTGG - Intergenic
978261700 4:106768052-106768074 CAAGGCAGTGGGATCCCTTCTGG - Intergenic
979664757 4:123298362-123298384 GCAGGGCCTGGGATGCCATCGGG - Intronic
979929875 4:126617228-126617250 TCAGGCCATGGGACTCCTTGAGG - Intergenic
980510481 4:133780039-133780061 CCAGGATCAGGGATGCCTTCAGG + Intergenic
980695975 4:136356138-136356160 CAAGGCCATGGGCTGCCGGCTGG - Intergenic
981298155 4:143156517-143156539 CAAGGCAATGGGTTTCCTTCTGG + Intergenic
982853449 4:160349181-160349203 CTAGGCCATGTGATTACTTCCGG + Intergenic
986310186 5:6545556-6545578 CCGGGCAATGTGATGCCTTCTGG - Intergenic
987163945 5:15174202-15174224 CAAGGCCATGGGTTCCCTTCTGG - Intergenic
988021395 5:25626873-25626895 CCAAGCCAAGGGAAGCCTTGAGG + Intergenic
989821646 5:45800410-45800432 CTGGGCCAAGGGATGCTTTCAGG - Intergenic
990637701 5:57747896-57747918 CCAGGCTATGAGAGGCCTTGGGG - Intergenic
991658445 5:68926636-68926658 CAAGGACGTAGGATGCCTTCAGG + Intergenic
992298838 5:75356408-75356430 CCAGGTCAGGGGATGCCATGGGG + Exonic
993306090 5:86277155-86277177 CCAGGCCACGGGATGCTCCCTGG + Intergenic
995697832 5:114899830-114899852 CAAGGCAATGGGTTACCTTCTGG + Intergenic
996790830 5:127291108-127291130 CCCGCCCATGAGAAGCCTTCCGG - Intronic
997025537 5:130056170-130056192 CCATGCCATCAGATACCTTCTGG - Intronic
997363718 5:133312057-133312079 CAAGTGGATGGGATGCCTTCAGG - Intronic
997756189 5:136401354-136401376 CCAGGCCTTAGGAGGCCTTGTGG + Intergenic
997981002 5:138467259-138467281 CCAGGCCCTGGAAGGGCTTCTGG - Exonic
1000011002 5:157232841-157232863 GCTGGCCATGGGGTGCCATCAGG + Intronic
1002699373 5:181111612-181111634 CCAGGCCAGAGGATCCCTTGAGG + Intergenic
1003791978 6:9556261-9556283 CGAGGCTATGGGATCCATTCAGG - Intergenic
1008707538 6:54181406-54181428 TCAGGCAATGGGCTCCCTTCTGG + Intronic
1010596497 6:77769747-77769769 CAAGGCAATGGGTTCCCTTCTGG - Intronic
1013520000 6:110924218-110924240 CCAGGCCATGGGGGGGCTCCTGG - Intergenic
1014327649 6:120018650-120018672 CCAGGACATGGGAGACCTTCAGG - Intergenic
1015902629 6:138083431-138083453 TCAGGCCATGGCATGGTTTCAGG - Intergenic
1017718063 6:157225685-157225707 CCAGGCCAAGGGCAGCCTGCGGG - Intergenic
1018045596 6:159963411-159963433 CAAGGGCATGAGATGCCTGCAGG + Intergenic
1018443499 6:163834529-163834551 CCAGGCCATGGGTGGCCTCCCGG - Intergenic
1018991148 6:168675354-168675376 CCAGGTCTTGGGGTGCCTTTGGG - Intergenic
1019613734 7:1949475-1949497 CCAGGCCATGGGCAGGCTCCAGG + Intronic
1019618135 7:1975823-1975845 CCCGGCCGTGTGATGTCTTCTGG - Intronic
1025791643 7:64693491-64693513 CCAGGTGATGGGATGCCCTCTGG + Intronic
1025804392 7:64816838-64816860 CCAGGTGATGGGATGCCCTCTGG + Intronic
1028297144 7:89147990-89148012 ACAGGGCAAGGGATGCTTTCGGG - Intronic
1029611350 7:101628095-101628117 CCAGGCCAGGGGACCCCCTCAGG + Intronic
1034427175 7:151020169-151020191 CCAGGTCCTGGGAAGGCTTCTGG - Intronic
1035166531 7:156993583-156993605 CCAGGCCCTGGGAAGCTCTCCGG - Intergenic
1035692243 8:1567898-1567920 TGAGGCCATGGAATGCTTTCTGG - Intronic
1039105704 8:33987114-33987136 CCAGGAAAAGGGATGCCTACTGG + Intergenic
1041081885 8:54222056-54222078 CCAGGCCATGGGCTGCGCTCGGG + Intergenic
1042082573 8:65071328-65071350 CAAGGCAATGGGTTCCCTTCTGG + Intergenic
1043337209 8:79191262-79191284 CAGGGCCGTGGGATGCATTCTGG - Intergenic
1045198737 8:99956985-99957007 CCATGCTGTGGGATGCTTTCAGG + Intergenic
1047338707 8:123959441-123959463 CCAGGCACTGGCATTCCTTCTGG + Intronic
1049499708 8:142955309-142955331 CAAGGCCACAGGATGACTTCAGG + Intergenic
1049545174 8:143227468-143227490 CCAGGCCAGAGGTTGCCTGCTGG + Intergenic
1049929130 9:439397-439419 CCAGGCCCCGGGATGCCCTCTGG - Intronic
1050248685 9:3719990-3720012 CCAGGCCCTGGAATTTCTTCTGG + Intergenic
1050913921 9:11107826-11107848 CAAGGCAGTGGGTTGCCTTCTGG - Intergenic
1051207353 9:14702270-14702292 CCAGGCCTGGGGATGATTTCTGG - Intergenic
1052093942 9:24362135-24362157 CCAGGCAATGGGTTCCTTTCTGG - Intergenic
1053428725 9:38027881-38027903 CCAGGGCAGGGGGTGCCTCCTGG + Intronic
1056332144 9:85529745-85529767 CAAGGCCATGGGATGCATGCAGG - Intergenic
1060281403 9:122218206-122218228 TCAGGCCCTGGGCTGACTTCTGG - Intronic
1061166891 9:128928138-128928160 CCATTCCCTGGGATGGCTTCCGG - Intronic
1061571141 9:131478067-131478089 CCAGGCCCTGGGCTGGGTTCTGG + Intronic
1061723293 9:132566999-132567021 CCAGGCACTGGGAGTCCTTCAGG + Intronic
1062436791 9:136549964-136549986 CCAGGCCCAGGGGTGCCTGCAGG + Intergenic
1062463796 9:136672518-136672540 CCTGGCCTTGGGATGCCGTTGGG - Exonic
1062474052 9:136718936-136718958 CCAGCCCAGGGGAGGCCTCCGGG + Intronic
1062485778 9:136774791-136774813 CCAGGCCATGGCAGGCGTACAGG - Intergenic
1062658137 9:137614646-137614668 CCAGGCCTGGGGCTGCCTCCTGG + Exonic
1187376975 X:18764147-18764169 CCAGGGCAAGGGATGCCCTGGGG + Intronic
1191052741 X:56212061-56212083 CAAGGCAATGGGTTGTCTTCTGG + Intergenic
1191123777 X:56932884-56932906 CCAGGCAGTGGTTTGCCTTCTGG - Intergenic
1192239589 X:69318907-69318929 CCTGGCCCTGAGAAGCCTTCTGG + Intergenic
1192822435 X:74658832-74658854 CCAGGCAGTGGGCTTCCTTCTGG + Intergenic
1193098296 X:77578537-77578559 CAAGGCAATGGGTTGCCTTCTGG - Intronic
1193260744 X:79403898-79403920 CAAGGCAATGGGTTCCCTTCTGG - Intergenic
1193933342 X:87583574-87583596 CAAGGCAATGGGTTTCCTTCTGG - Intronic
1194237777 X:91406055-91406077 TCAGGTAATGTGATGCCTTCTGG - Intergenic
1196247356 X:113415500-113415522 CAAGGCAATGGGTTCCCTTCTGG - Intergenic
1197023790 X:121722307-121722329 CCAGGGGATGAGAAGCCTTCTGG + Intergenic
1197244022 X:124149791-124149813 CCAGGGCATGGTTTACCTTCAGG + Intronic
1198292984 X:135256932-135256954 CAAGGCAATGGGCTCCCTTCTGG - Intronic