ID: 1141579319

View in Genome Browser
Species Human (GRCh38)
Location 16:84986464-84986486
Sequence CGGCTGCCGAGAAGGCTCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141579311_1141579319 10 Left 1141579311 16:84986431-84986453 CCCCATGAAGGCTACCTCCGGAA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1141579319 16:84986464-84986486 CGGCTGCCGAGAAGGCTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1141579316_1141579319 -4 Left 1141579316 16:84986445-84986467 CCTCCGGAAGGCACTCGCACGGC 0: 1
1: 0
2: 0
3: 1
4: 36
Right 1141579319 16:84986464-84986486 CGGCTGCCGAGAAGGCTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1141579312_1141579319 9 Left 1141579312 16:84986432-84986454 CCCATGAAGGCTACCTCCGGAAG 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1141579319 16:84986464-84986486 CGGCTGCCGAGAAGGCTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1141579313_1141579319 8 Left 1141579313 16:84986433-84986455 CCATGAAGGCTACCTCCGGAAGG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1141579319 16:84986464-84986486 CGGCTGCCGAGAAGGCTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1141579317_1141579319 -7 Left 1141579317 16:84986448-84986470 CCGGAAGGCACTCGCACGGCTGC 0: 1
1: 1
2: 0
3: 5
4: 82
Right 1141579319 16:84986464-84986486 CGGCTGCCGAGAAGGCTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 39
1141579308_1141579319 28 Left 1141579308 16:84986413-84986435 CCTGGACAGCAGTCGCGGCCCCA 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1141579319 16:84986464-84986486 CGGCTGCCGAGAAGGCTCGTAGG 0: 1
1: 0
2: 0
3: 1
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141579319 Original CRISPR CGGCTGCCGAGAAGGCTCGT AGG Intronic
900353583 1:2248938-2248960 CGGCTCCTGAGATGGCTTGTGGG - Intronic
901791355 1:11655007-11655029 GGGCTGCCGGGAAGGCTCCTGGG + Intronic
902327991 1:15715163-15715185 AGGCTGGCAAGAAGGCTGGTGGG + Intronic
907467919 1:54651709-54651731 TGGCTGCCCAGAAGGCCAGTGGG + Intronic
912389979 1:109296320-109296342 GGGCTTCAGAGAAGTCTCGTTGG + Exonic
1067451652 10:46385390-46385412 CGGCAGGCGAGAAGATTCGTGGG + Exonic
1067585587 10:47474366-47474388 CGGCAGGCGAGAAGATTCGTGGG - Exonic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1072152624 10:92695959-92695981 CGGCTGCCGAGGAGAATCGATGG - Intergenic
1074065371 10:110008248-110008270 CGGCTGCCGAGAAGGAGGGAGGG + Exonic
1084207579 11:67604921-67604943 ATGCTGCAGAGAAGGCTCCTGGG + Exonic
1095150574 12:38790435-38790457 AGGCTGCTGAGAAGGGTAGTAGG + Intronic
1104987272 12:132604061-132604083 GGGCCGCAGAGAAGGCTCCTGGG - Intronic
1124633548 15:31350860-31350882 CTGCTGCCCAGAAGGCGCCTGGG - Intronic
1134396958 16:13873981-13874003 CGGCTGGAGAGAGGGCTCCTTGG - Intergenic
1141064152 16:80900474-80900496 CGGCTGCCTCAAAGGCTCCTGGG + Intergenic
1141579319 16:84986464-84986486 CGGCTGCCGAGAAGGCTCGTAGG + Intronic
1141839813 16:86567312-86567334 CTGCTTCCGAGACGGCTCGCCGG - Exonic
1146929200 17:36765891-36765913 AGGCTGCTGTGAAGGCTCCTGGG - Intergenic
1162947650 19:14053683-14053705 AGGCTGCCGGGCAGGCGCGTAGG + Exonic
932398818 2:71466040-71466062 CCGCTGCGGAGAAGGCTCCGAGG + Intronic
942681450 2:178480951-178480973 GGGCTGCTGAGAAGGCGGGTCGG + Intronic
1171959300 20:31482463-31482485 CCGCTGCCGAGAAGTCTCTGTGG + Exonic
1177128677 21:17229286-17229308 CTGCTCCCAGGAAGGCTCGTTGG + Intergenic
1183773637 22:39948037-39948059 GGGCGTCCGAGAAGGCTCATTGG - Intronic
961359391 3:126357461-126357483 CGGGCGCCGCGAAGGCTCGCAGG + Intergenic
966355128 3:179071725-179071747 CGGCTGCGGAGGGGGCTCGGCGG - Exonic
966996223 3:185283146-185283168 CGGCTGAAGAAAAGGCTCCTTGG + Intronic
999156968 5:149464935-149464957 AGGCTGCCGAGCAGGCTGCTGGG - Intergenic
1001109261 5:168882213-168882235 GGGCTGCAGAGAAGGCTGCTGGG + Intronic
1002341495 5:178519115-178519137 CTGCTGTTGAGAAGGCTCGAAGG - Intronic
1005815964 6:29553268-29553290 CGGCTGCAGGGAAGGCCAGTCGG - Intergenic
1008546455 6:52587968-52587990 CGGCTGCCAAGAAGGCACTATGG - Intergenic
1016804743 6:148201668-148201690 GGGGTGCCCAGAAGGCTCCTGGG + Intergenic
1018196518 6:161360164-161360186 GAGCCGCCGAGCAGGCTCGTTGG - Exonic
1019667086 7:2257332-2257354 GGGCGGCCGAGCAGGCCCGTGGG - Intronic
1025959084 7:66205077-66205099 CGGCTGCCGGGAAGCCCCCTCGG + Intergenic
1032153588 7:129450752-129450774 AGGCTGCAGAGAAGGCCCTTGGG - Intronic
1034838762 7:154376045-154376067 CGGTTTCCGGGAAGGCTGGTGGG - Intronic
1189763243 X:44343721-44343743 GGGTTGGCGAGAAGGATCGTGGG + Intergenic
1197853564 X:130890378-130890400 CGGCTGCCGAGGAGGAGCTTGGG - Intronic