ID: 1141582830

View in Genome Browser
Species Human (GRCh38)
Location 16:85011809-85011831
Sequence GTGTGTACCCGCGCCCGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141582817_1141582830 28 Left 1141582817 16:85011758-85011780 CCAAGCCACGCCGTTAGGCTGCG No data
Right 1141582830 16:85011809-85011831 GTGTGTACCCGCGCCCGCGGCGG No data
1141582822_1141582830 18 Left 1141582822 16:85011768-85011790 CCGTTAGGCTGCGGAACCGGGTT No data
Right 1141582830 16:85011809-85011831 GTGTGTACCCGCGCCCGCGGCGG No data
1141582819_1141582830 23 Left 1141582819 16:85011763-85011785 CCACGCCGTTAGGCTGCGGAACC No data
Right 1141582830 16:85011809-85011831 GTGTGTACCCGCGCCCGCGGCGG No data
1141582825_1141582830 2 Left 1141582825 16:85011784-85011806 CCGGGTTGGGAATGCCCTTAGCG No data
Right 1141582830 16:85011809-85011831 GTGTGTACCCGCGCCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141582830 Original CRISPR GTGTGTACCCGCGCCCGCGG CGG Intergenic
No off target data available for this crispr