ID: 1141584699

View in Genome Browser
Species Human (GRCh38)
Location 16:85025953-85025975
Sequence CAGATCAGTGAACCTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141584699_1141584701 17 Left 1141584699 16:85025953-85025975 CCAATGTCAGGTTCACTGATCTG No data
Right 1141584701 16:85025993-85026015 TTTCTTCCTCTTTTAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141584699 Original CRISPR CAGATCAGTGAACCTGACAT TGG (reversed) Intergenic
No off target data available for this crispr