ID: 1141585376

View in Genome Browser
Species Human (GRCh38)
Location 16:85030006-85030028
Sequence CTGTGGAATGGGAAGTGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 884
Summary {0: 2, 1: 0, 2: 3, 3: 63, 4: 816}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141585364_1141585376 16 Left 1141585364 16:85029967-85029989 CCCAACCGTCTGACGCTGGATAT No data
Right 1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG 0: 2
1: 0
2: 3
3: 63
4: 816
1141585365_1141585376 15 Left 1141585365 16:85029968-85029990 CCAACCGTCTGACGCTGGATATA 0: 1
1: 0
2: 0
3: 2
4: 14
Right 1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG 0: 2
1: 0
2: 3
3: 63
4: 816
1141585366_1141585376 11 Left 1141585366 16:85029972-85029994 CCGTCTGACGCTGGATATAGCAG 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG 0: 2
1: 0
2: 3
3: 63
4: 816

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141585376 Original CRISPR CTGTGGAATGGGAAGTGGGG CGG Intronic
900405051 1:2489329-2489351 CTGTGGAGAGGGGAGTGTGGTGG - Exonic
900847583 1:5115953-5115975 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
901635019 1:10666494-10666516 CTGGGGGCTGGGAAGTGGGCTGG - Intronic
901648465 1:10729083-10729105 CTGGGGGAAGGGGAGTGGGGAGG + Intronic
901789635 1:11647565-11647587 CTGGGGGAGGGGAGGTGGGGAGG - Intergenic
901974705 1:12935264-12935286 CTGTTGTGTGGGGAGTGGGGAGG - Intronic
902010468 1:13266500-13266522 CTGTTGTGTGGGGAGTGGGGAGG + Intergenic
902817227 1:18923247-18923269 CTGGGGAATGGGGAGTGTCGGGG - Intronic
903170390 1:21548763-21548785 CTGTGGGAATGGCAGTGGGGAGG - Intronic
903320038 1:22537585-22537607 GTGTGTGATGGGAAGTGGGAGGG - Intergenic
903796076 1:25929851-25929873 CTGTGGAATGTGGGGTTGGGGGG - Intergenic
904310186 1:29624217-29624239 CTGTGAAATGAGAAATGGGTAGG + Intergenic
904565393 1:31425440-31425462 CTGTGGGGAGGGAAGTGGGGCGG + Intronic
904996386 1:34634837-34634859 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
905500845 1:38435065-38435087 CTGTGCATTGAGAAGTGGGCTGG - Intergenic
905521990 1:38607664-38607686 CTGGGAAGTGGGCAGTGGGGAGG + Intergenic
905812636 1:40923717-40923739 TTGTGGGATGGGAATGGGGGCGG + Intergenic
905820472 1:40986287-40986309 GAGTGGAATGAGAAGTGCGGAGG + Intronic
906138164 1:43515103-43515125 CTGTGGAGTGGACAGTGGGTGGG - Intergenic
906733532 1:48103156-48103178 TTGTGGGAAAGGAAGTGGGGAGG + Intergenic
907268269 1:53275815-53275837 CTATGGCATGGGGATTGGGGTGG - Intronic
907521363 1:55025426-55025448 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
908461608 1:64352847-64352869 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
908591850 1:65644757-65644779 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
908768176 1:67572598-67572620 CTGTGAAATGGGAGTTTGGGAGG + Intergenic
908852513 1:68389095-68389117 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
908934824 1:69362656-69362678 CTGTCGAATGGGAAAGTGGGAGG - Intergenic
909191645 1:72559850-72559872 TTGTGTAATAGGAGGTGGGGTGG - Intergenic
909222566 1:72982721-72982743 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
909223555 1:72990695-72990717 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
909550928 1:76897653-76897675 CTTTGGATTGGGAAGAAGGGCGG + Intronic
909788169 1:79641610-79641632 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
909978347 1:82070396-82070418 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
910645514 1:89510094-89510116 GTGGGGTAGGGGAAGTGGGGCGG - Intergenic
910775954 1:90875036-90875058 CTAGGGAATGGGAAGTGAGGTGG - Intergenic
911570492 1:99512450-99512472 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
911748563 1:101468612-101468634 CTGAGGAATGGGAAGGGGAAGGG + Intergenic
912563270 1:110565568-110565590 CTGGGGAAGGGGATGTGGGGTGG + Intergenic
912638361 1:111320116-111320138 CTGTGGGAGTGGAAGTGTGGAGG - Intronic
913538713 1:119798454-119798476 CTGCGCATTGGGAAGTGGTGAGG + Intronic
914196313 1:145449820-145449842 CCAGGGAATGGGAAGTGTGGAGG - Intergenic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
915935354 1:160087417-160087439 TTGTGGAATGAGAAGAGGAGAGG + Intronic
916014366 1:160735932-160735954 GTGGGGAGTGGGGAGTGGGGAGG - Intergenic
916578797 1:166089710-166089732 CTCTGGAATGGGGGGTGAGGGGG + Intronic
916787055 1:168093945-168093967 CCGAGGAATGGGAGCTGGGGTGG - Intronic
917242214 1:172960690-172960712 CTGTGAAATGGGAATTTAGGTGG - Intergenic
917454696 1:175176402-175176424 CTGTGGAATGTTCAGTGTGGTGG + Intronic
917485689 1:175452592-175452614 CTGTAGCCTGGGAAGTTGGGGGG + Intronic
917610526 1:176684546-176684568 TAGTAGAATGGGGAGTGGGGGGG - Intronic
917668408 1:177248026-177248048 CTGTGGACTTGGAAATGGGCCGG + Intronic
917725300 1:177822041-177822063 CCATGGCTTGGGAAGTGGGGTGG + Intergenic
918003983 1:180524739-180524761 ATGTGGAATCAGAAGTAGGGAGG + Intergenic
918308362 1:183267598-183267620 CTGTGCCCTGGGGAGTGGGGGGG + Intronic
918347220 1:183616478-183616500 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
918567567 1:185951179-185951201 CTTTGGATTGGGAAGAAGGGCGG + Intronic
919146873 1:193646582-193646604 GTGTGGGATGGGTAGTTGGGGGG - Intergenic
919280345 1:195482100-195482122 CTGTGAAGAGAGAAGTGGGGAGG + Intergenic
919542719 1:198871506-198871528 TTGTGGGATGGGAGGTGGGGAGG - Intergenic
919742572 1:200989789-200989811 CTGTGGCATGGGAGGTGCAGAGG + Intronic
919757628 1:201075722-201075744 CTGTGGAATGAAAAGAGGGAAGG - Intronic
920103955 1:203537241-203537263 GTGAGGAATGGGATGAGGGGAGG + Intergenic
920347038 1:205313061-205313083 CTGGGGGAGGGGAAATGGGGAGG + Intronic
920682556 1:208083918-208083940 ATGTGGAATGGGGTGTAGGGTGG + Intronic
920867982 1:209769072-209769094 CTATGGAATGGGGAGAGAGGAGG + Intronic
921212521 1:212912331-212912353 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
921459673 1:215412826-215412848 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
921520240 1:216148374-216148396 CTTTGGATTGGGAAGAAGGGCGG - Intronic
921732872 1:218596672-218596694 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
921902559 1:220466133-220466155 TTGTGGAATAGAAAGGGGGGAGG - Intergenic
922153965 1:223027290-223027312 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
922240241 1:223750962-223750984 CGGTGGAATGACAAGTGAGGAGG + Exonic
923214097 1:231833090-231833112 CTTTGGATTGGGAAGAAGGGCGG + Intronic
923244855 1:232121009-232121031 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
923408525 1:233686315-233686337 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
924180752 1:241436797-241436819 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1063221738 10:3975229-3975251 CTGTGGGCTGGGAAGAGGGGCGG + Intergenic
1063363260 10:5473937-5473959 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1063509493 10:6632479-6632501 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1063527578 10:6799978-6800000 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1063580272 10:7300163-7300185 CTGGGGGATGGGGAGTGGAGGGG + Intronic
1066278066 10:33888065-33888087 CTGGGGAATGGGGAATGGAGAGG + Intergenic
1066279661 10:33903705-33903727 CTGGGGAGTGGGATTTGGGGAGG - Intergenic
1067450837 10:46380948-46380970 GTGTGGGGTGGGAAATGGGGAGG + Intronic
1067586406 10:47478803-47478825 GTGTGGGGTGGGAAATGGGGAGG - Intronic
1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG + Intronic
1068058246 10:52036649-52036671 CTTTGGATTGGGAAGAAGGGCGG + Intronic
1068179555 10:53501916-53501938 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1068231076 10:54169582-54169604 CTTTGGATTGGGAAGAAGGGCGG - Intronic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1068592239 10:58863899-58863921 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1069493011 10:68877743-68877765 CTGTGAACTTGGAGGTGGGGTGG - Intronic
1069514355 10:69065801-69065823 GTGTGGAGTGGCAAGTGGAGAGG + Intergenic
1069853154 10:71423578-71423600 CTGGAGAATGGGATGAGGGGAGG + Intronic
1069855077 10:71435742-71435764 GTGCTGAATGGGAAGTGAGGAGG + Intronic
1070475031 10:76821399-76821421 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1070684646 10:78471686-78471708 CTGTGGCATGTGAATTGTGGGGG + Intergenic
1071299758 10:84247751-84247773 CTGTGGACTGGGGAGGGGGCTGG - Intronic
1072580367 10:96735043-96735065 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1072763269 10:98075798-98075820 CTTTGGAGAGGGAAGTGGGGAGG + Intergenic
1073019215 10:100427749-100427771 CTGTGGACTACTAAGTGGGGAGG + Intergenic
1073072550 10:100803739-100803761 CAGAGGAGAGGGAAGTGGGGAGG - Intronic
1073184717 10:101608992-101609014 TTATGGGATGGGAAGTGGGCAGG - Intronic
1074353189 10:112758147-112758169 CTGTGGAATGGGAAGTTCTCAGG + Intronic
1074714997 10:116210240-116210262 CTGGAGAATGGGGAGAGGGGAGG - Intronic
1074917046 10:117967651-117967673 CTTTGGCATGGAAATTGGGGCGG - Intergenic
1075248803 10:120847669-120847691 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1075915421 10:126162293-126162315 GAGAGGAATGGGAAATGGGGAGG + Intronic
1076207884 10:128617722-128617744 CTGTGGAGTGTGAAGGGTGGGGG - Intergenic
1076354425 10:129841665-129841687 CTGTGGGATGGGGTGCGGGGTGG + Intronic
1076541151 10:131215672-131215694 CTGTGGAGAGGGAAGAGGAGGGG + Intronic
1076578174 10:131485597-131485619 ATGTGGAAGGGGAAATGGGTAGG + Intergenic
1077246975 11:1544459-1544481 CTGCAAAATGGGAATTGGGGAGG - Intergenic
1077333659 11:1994155-1994177 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1077738509 11:4818007-4818029 GGGAGGAATGGGAAGTGGAGAGG + Intronic
1077850695 11:6072718-6072740 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1078046030 11:7915045-7915067 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1078845004 11:15112632-15112654 GTGTGTATTGGGAAGTGGGGGGG + Intronic
1078928962 11:15898722-15898744 ATGTGGGATGGAAGGTGGGGAGG + Intergenic
1079447564 11:20570618-20570640 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1080027811 11:27631965-27631987 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1080665123 11:34329358-34329380 GGGTGGAGTGGGAAGTGGGATGG - Intronic
1080781740 11:35435926-35435948 CTGAGGACTGGGAAGTGGAGTGG - Exonic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1082167589 11:48965928-48965950 CTTTGGAGTGGGAAGTAGAGGGG - Intergenic
1082181791 11:49128904-49128926 CTGGGGTGGGGGAAGTGGGGAGG - Intergenic
1082279640 11:50257930-50257952 CTGTGGGGTGTGATGTGGGGTGG - Intergenic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1082813874 11:57495580-57495602 CTTTGGAAGGGCAAGGGGGGAGG + Intronic
1084355654 11:68636533-68636555 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1084358516 11:68654536-68654558 GGGTGTAGTGGGAAGTGGGGAGG - Intergenic
1084537907 11:69768686-69768708 CTGTGGGATGGGCAGGGAGGAGG - Intergenic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1085040095 11:73321964-73321986 CTGTGGAGCAGGAAGCGGGGAGG + Intronic
1085313604 11:75530445-75530467 ATGTGGAATGGGGAGTGGAGAGG + Intergenic
1085776666 11:79372680-79372702 CTGTGAAATGGGAGGGGAGGGGG + Intronic
1085839939 11:80000264-80000286 CTGTGCAATGGGAAGTAAGTTGG + Intergenic
1086106821 11:83156574-83156596 CTGGGAACTGGGAAGTGGGAGGG - Intergenic
1086136164 11:83445783-83445805 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1086414717 11:86577086-86577108 CTTTAGAATGGGAACAGGGGAGG - Intronic
1086683706 11:89705962-89705984 CTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1086743485 11:90397441-90397463 ATTTGGAATGGGCAGTGGAGGGG + Intergenic
1087099737 11:94352475-94352497 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1087127912 11:94644433-94644455 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1087314780 11:96590754-96590776 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1087839438 11:102906964-102906986 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1088188089 11:107195949-107195971 GTGGGGTAGGGGAAGTGGGGAGG + Intergenic
1088559213 11:111096060-111096082 CCCTCTAATGGGAAGTGGGGTGG + Intergenic
1089648209 11:119894123-119894145 CTGTAAAATGGGGAGTTGGGGGG + Intergenic
1089987772 11:122829942-122829964 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1090575839 11:128102566-128102588 CTGTGGAATGGGAATAGGTTTGG + Intergenic
1202816640 11_KI270721v1_random:49337-49359 CTGTGCACTGGGAATGGGGGTGG + Intergenic
1091657593 12:2356824-2356846 CTGTGGAATGGGAATGCAGGTGG - Intronic
1091799182 12:3313947-3313969 CTGAGTAATGGGAAGGGTGGAGG - Intergenic
1091822777 12:3489141-3489163 CTTTGGAATGGGGAGTGGAGAGG - Intronic
1091823569 12:3493204-3493226 CTGGGGAAGAGGAAGTGGTGAGG - Intronic
1091845767 12:3655314-3655336 CTGTGGATGGGGAAATGGGGAGG + Intronic
1091905955 12:4189296-4189318 CTGTGGAAATGGCAATGGGGTGG + Intergenic
1092027998 12:5259150-5259172 CAGTGGCTTGGGATGTGGGGGGG - Intergenic
1092154541 12:6273841-6273863 CTGGGGCATGGGGAGTGGGGTGG + Intergenic
1092337106 12:7642846-7642868 TTGTGCTATGGGAAGAGGGGAGG - Intergenic
1092566827 12:9674325-9674347 CTGAGGTAAGGGAAGTGGCGAGG - Intronic
1092626649 12:10335810-10335832 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1092719691 12:11429365-11429387 ATGTGGACTCGGGAGTGGGGAGG - Intronic
1092723623 12:11465065-11465087 CTTTGGATTGGGAAGAAGGGCGG + Intronic
1092739226 12:11612591-11612613 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1092924755 12:13262855-13262877 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1093071062 12:14707755-14707777 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1093358531 12:18197780-18197802 CTTTGGATTGGGAAGAAGGGAGG - Intronic
1093651962 12:21656957-21656979 CTGGGGAATGGGGGGAGGGGAGG - Intronic
1095637750 12:44452622-44452644 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096079873 12:48826213-48826235 CAGAGGAATGGGAATTGAGGAGG - Intronic
1096387852 12:51206761-51206783 TTCTGGGGTGGGAAGTGGGGGGG - Intronic
1096805938 12:54141146-54141168 CTGGGGAATGTGGAGAGGGGAGG - Intergenic
1097416952 12:59326102-59326124 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1097735107 12:63173918-63173940 TTGTGGGGTGGGAGGTGGGGAGG - Intergenic
1097880430 12:64681518-64681540 ATGTGGGATGGGAAGTTGGCAGG - Intronic
1098152153 12:67557830-67557852 CTGAGGAATGGGAAATAGGAAGG - Intergenic
1098173535 12:67769530-67769552 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1098876767 12:75873652-75873674 CTGTGGCAAGGGGAGTTGGGTGG + Intergenic
1099208799 12:79759648-79759670 TTGTGGGATGGGGAGAGGGGGGG - Intergenic
1099704855 12:86138928-86138950 CTGTGCAAGAGGATGTGGGGAGG + Intronic
1099983583 12:89636210-89636232 ATGTGGGGTGGGAGGTGGGGAGG + Intronic
1100145700 12:91674953-91674975 CTGTGGGAAGGGGAGTGGGAAGG - Intergenic
1100283081 12:93137205-93137227 CTGGGGTGGGGGAAGTGGGGAGG + Intergenic
1100354693 12:93818358-93818380 CTAGGGAGTGGGGAGTGGGGAGG - Intronic
1100561466 12:95752003-95752025 CTTTGGATTGGGAAGAAGGGCGG - Intronic
1100940451 12:99718325-99718347 CTTTGGATTGGGAAGAAGGGTGG - Intronic
1101278295 12:103225561-103225583 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1101456810 12:104841130-104841152 CTGGGGAAGTGGAAGTGGAGGGG - Intronic
1101675644 12:106914085-106914107 GTGGGGAGTGGGCAGTGGGGTGG + Intergenic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102977226 12:117215325-117215347 CTGTGGAAAGAGAAGTTGGGGGG + Intronic
1103898337 12:124289389-124289411 CTGTGGAGTGGGAACGGGAGGGG + Intronic
1104108022 12:125681576-125681598 ATGTGGAAGGGGAAATGGTGGGG + Intergenic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1105496422 13:20934671-20934693 ATGTGGAATGGGAAATGAGAGGG - Intergenic
1105767049 13:23570568-23570590 CTGTGGACTAGGAGGTGGGAGGG + Intronic
1105890313 13:24677898-24677920 CTGAGGGATGGGGAGCGGGGAGG - Intergenic
1106841070 13:33685504-33685526 TTGTGGAAGGGGCAGTGGTGGGG - Intergenic
1106943541 13:34801464-34801486 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1107075686 13:36319271-36319293 CTTTGGATTGGGAAGAAGGGTGG - Intronic
1107220198 13:37972058-37972080 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1107235528 13:38165006-38165028 CCAAGGAATGGGAAGTGGGGAGG + Intergenic
1107522742 13:41199621-41199643 TTGTGTAAGGGGTAGTGGGGAGG + Intergenic
1107850449 13:44567170-44567192 CTGTGGGGTGGGCAGTGAGGGGG - Intronic
1108202794 13:48059222-48059244 CTTTGGATTGGGAAGAAGGGCGG - Intronic
1108803770 13:54130571-54130593 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1108814232 13:54269687-54269709 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1108913317 13:55581126-55581148 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1108919445 13:55657856-55657878 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1108947537 13:56043135-56043157 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1108952845 13:56115299-56115321 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1109353012 13:61207630-61207652 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1109709560 13:66144216-66144238 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1109716641 13:66229266-66229288 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1111013190 13:82339646-82339668 CCATGGATTGGGAAGGGGGGTGG - Intergenic
1111125937 13:83911165-83911187 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1111359245 13:87153001-87153023 GTGGGGAATGGGAAGGGGGGAGG + Intergenic
1111458737 13:88515710-88515732 CTTTGGATTGGGAAGAAGGGAGG + Intergenic
1112236929 13:97645142-97645164 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1112346700 13:98596231-98596253 CTGTGGAAGGCCAAGGGGGGTGG - Intergenic
1113120211 13:106917477-106917499 CTGAGGGATGGGAAACGGGGAGG - Intergenic
1113251042 13:108452797-108452819 CTGTGGGAGGGGGAGTGAGGAGG + Intergenic
1113449885 13:110401166-110401188 CTGTTAATTGGGAGGTGGGGAGG + Intronic
1113823354 13:113231438-113231460 GTGGGGAGTGGGAGGTGGGGAGG + Intronic
1114650083 14:24279265-24279287 GTGGGGAATGGGCAGTGGAGAGG - Intergenic
1114669956 14:24405152-24405174 CTCTGGAATTGGAAGTGAAGGGG - Intronic
1114825894 14:26079019-26079041 AGGTGGAATGGGGAGTGGGGAGG + Intergenic
1115217525 14:31027093-31027115 TTCTGGAATGGGTTGTGGGGGGG + Intronic
1115904908 14:38193622-38193644 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1116179784 14:41518774-41518796 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1116435564 14:44891970-44891992 CTGCTGAATGGGAAGTCTGGAGG + Intergenic
1116448668 14:45039897-45039919 CTGTGGCAGGGGAAGTGCGCTGG - Intronic
1116490481 14:45498266-45498288 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1116702302 14:48258264-48258286 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1116785812 14:49287707-49287729 CTGTGGAAAGGGTAGGGGAGAGG - Intergenic
1116953017 14:50896002-50896024 CTTTGGATTGGGAAGAAGGGCGG - Intronic
1117013124 14:51491050-51491072 AAGTTGAATGGGGAGTGGGGTGG + Intronic
1117375027 14:55111979-55112001 CTGTGGAATGGGCTGTGCAGGGG + Intergenic
1118079061 14:62337184-62337206 GAGTGGAATGAGAAGTGGGAGGG + Intergenic
1119092933 14:71801416-71801438 CTGTGGGATGGGATGGGGGATGG - Intergenic
1119317303 14:73706325-73706347 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1119475333 14:74923445-74923467 GGGTGGGATGGGATGTGGGGTGG + Intergenic
1119617840 14:76110590-76110612 CTGTGAAGTGGGGAGTGGGCCGG + Intergenic
1119884773 14:78131048-78131070 CTTTGGAATGGGAGGTCAGGAGG - Intergenic
1120251299 14:82063968-82063990 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1121124194 14:91395526-91395548 AGGTGGAATGGGAGGTGGGAAGG - Intronic
1121703748 14:95975779-95975801 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1121724341 14:96135563-96135585 CTGTGGTCTGAGAAGTGGCGGGG + Intergenic
1121794737 14:96725514-96725536 CTGTGGGCTGGGAAGGTGGGAGG - Intergenic
1121937894 14:98037292-98037314 ATGGGAAGTGGGAAGTGGGGAGG - Intergenic
1122246375 14:100406044-100406066 CTGTGGGAAGGGATGTGTGGTGG + Intronic
1122267112 14:100551862-100551884 GTGGGGAAGGGGAAGTGGGTCGG + Intronic
1122400257 14:101462868-101462890 GAGTGGAATTGGAAGGGGGGAGG - Intergenic
1202927341 14_KI270724v1_random:39142-39164 CTTTGGAATGTCAAGAGGGGAGG + Intergenic
1123829082 15:24115448-24115470 CTGGGTAATGGGAAGTGTGATGG - Intergenic
1123844002 15:24278892-24278914 CTGGGTAATGGGAAGTGTGATGG - Intergenic
1123859079 15:24445174-24445196 CTGGGTAATGGGAAGTGTGATGG - Intergenic
1124018344 15:25897710-25897732 CTGTAGAAAGGAAAGTAGGGTGG - Intergenic
1125616809 15:41021691-41021713 CTGGGGAAGGGGGAGTGCGGAGG + Intronic
1128624322 15:69183836-69183858 CTGTGGTATGAGGAGTTGGGAGG + Intronic
1128923052 15:71629670-71629692 ATGTGGAGTGGGGTGTGGGGAGG - Intronic
1129156187 15:73719622-73719644 GTGTGAGATGGGAGGTGGGGGGG - Intergenic
1129158691 15:73734808-73734830 CTGTGGAATGGGAGATGGGTGGG + Intergenic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129238307 15:74236868-74236890 CTGTGAAATGGGGAGTGAGGTGG + Intronic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1129826973 15:78640788-78640810 CTGTGGGCTGGGCAGTGGGCTGG - Intronic
1130066579 15:80609680-80609702 CTGCGAAATGGGAGGTGGGAGGG + Intergenic
1130332604 15:82933850-82933872 CTTGGGCATGGGGAGTGGGGCGG - Intronic
1130420123 15:83737203-83737225 CTTAGAAATGGGAAGTGTGGGGG + Intronic
1130668145 15:85886956-85886978 CAGTAGAAAGGGAAGTGGGTTGG + Intergenic
1130791231 15:87158327-87158349 ATGGGGAATGGGAAGTCAGGTGG - Intergenic
1130855209 15:87834096-87834118 CTTTGGATTGGGAAGAAGGGAGG - Intergenic
1130945844 15:88550382-88550404 CTTTGGATTGGGAAGAAGGGAGG + Intergenic
1131254695 15:90854384-90854406 CTGTGTGATGGGGAGTGGGGGGG + Intergenic
1131447846 15:92514337-92514359 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1131714592 15:95094778-95094800 GTGGGGAATGGGAGGTTGGGAGG - Intergenic
1131882409 15:96874705-96874727 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1132357718 15:101185162-101185184 GTGTGGAATGGGAGATGGAGAGG + Intronic
1132682004 16:1146265-1146287 CTGTGGAGTGGGAAGGAGGAGGG - Intergenic
1132690872 16:1181290-1181312 CAGTGGAGTGGGAGGTGGAGGGG - Intronic
1133064229 16:3194743-3194765 TTGCGGAATTGGAAGTGAGGTGG + Intergenic
1133086270 16:3366036-3366058 CTTGGGGATGGGGAGTGGGGTGG - Intronic
1133765629 16:8835905-8835927 CTTTGGATTGGGAAGAAGGGCGG + Intronic
1134304071 16:13016472-13016494 TTGTGTAATGGGCAGTGGTGAGG + Intronic
1134342075 16:13355449-13355471 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1134562012 16:15219039-15219061 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1134644794 16:15857439-15857461 CAATAAAATGGGAAGTGGGGTGG - Intergenic
1134922550 16:18130665-18130687 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1135774170 16:25241805-25241827 CTGTGGCATGGGATGGGGAGAGG + Intronic
1136620676 16:31426676-31426698 CTCTGTAATGGTAAGTGGGCAGG + Intergenic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1137750208 16:50855890-50855912 CTGTGGACTTTGAGGTGGGGAGG - Intergenic
1138148211 16:54631214-54631236 CTGAGGAATGGGTTGGGGGGTGG + Intergenic
1138261135 16:55623526-55623548 GTGTGGAATGGGAATGGGGAAGG - Intergenic
1138522460 16:57578659-57578681 ATTTGGAATTGGGAGTGGGGAGG - Intronic
1138528783 16:57623641-57623663 CTGGGGGATGGGCAGTGGGTGGG + Intronic
1138775486 16:59718365-59718387 CTTTGGGATGGCAAGTCGGGTGG + Intronic
1138805054 16:60081659-60081681 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1138877742 16:60973492-60973514 CTGTGGAAGGGGACCTGAGGGGG - Intergenic
1139356728 16:66371265-66371287 CTGTGGAATGGGAAAGCGGTGGG + Intronic
1139942951 16:70619345-70619367 CTTTGGATTGGGAAGAAGGGTGG + Intronic
1139943625 16:70623676-70623698 CTTTGGATTGGGAAGAAGGGTGG + Intronic
1140127617 16:72131268-72131290 GACTGGAAAGGGAAGTGGGGAGG + Intronic
1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG + Intronic
1141876531 16:86828835-86828857 ATGTGCAGTGGGAAGTGGCGGGG - Intergenic
1141907899 16:87039771-87039793 CTGTGTAAAGAGCAGTGGGGGGG + Intergenic
1142230714 16:88899062-88899084 CTGTGGGGTGGGGGGTGGGGAGG - Intronic
1142389851 16:89792162-89792184 CTTTGCAGTGGGAAGTGAGGGGG - Intronic
1142696961 17:1639108-1639130 CCGTGAAATGGGCAGCGGGGTGG - Intronic
1143016595 17:3893859-3893881 CTAAGGGAGGGGAAGTGGGGTGG - Intronic
1143614652 17:8042620-8042642 CTGTGGGATTGGTAGTGGGAAGG - Intronic
1143861862 17:9897127-9897149 CTGTGGAGTTGGAAGTAGGAGGG - Exonic
1144113499 17:12062891-12062913 CTGGGAAAAGGGAAGAGGGGAGG - Intronic
1144339165 17:14298360-14298382 CTGCGGAATGGGAAGACGGTTGG + Intergenic
1144706410 17:17371231-17371253 CTGGGGGATTGGAACTGGGGAGG - Intergenic
1144740690 17:17580683-17580705 ATGGGGAATGGGGAGTGGGAGGG - Intronic
1145961965 17:28892100-28892122 CTCTGACCTGGGAAGTGGGGTGG + Intronic
1146196237 17:30815463-30815485 CTTTGGGATGGCAAGTTGGGTGG - Intronic
1147878311 17:43637432-43637454 CTGTGGAATGGAAGGTGGCTTGG + Intergenic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1148853790 17:50567621-50567643 CTGGGGAATGGGGATGGGGGAGG - Intronic
1148979577 17:51560746-51560768 CAGTGGAATGGGAGATTGGGAGG - Intergenic
1148988832 17:51647549-51647571 CTGGGGGATGGGTGGTGGGGTGG + Intronic
1149187834 17:54021975-54021997 CTGTGCAATGGGATGTGAGGAGG + Intergenic
1149545379 17:57499657-57499679 CTGTGGAGCGGGAATTTGGGCGG + Intronic
1150519386 17:65850391-65850413 CTGGGGGGTGGGAAGTAGGGTGG - Intronic
1151279881 17:73065502-73065524 CTGTGGAATTGGAAGAGGCAGGG - Intronic
1151417696 17:73977271-73977293 CTGGGTAATGGGAGGTGAGGAGG + Intergenic
1151522683 17:74641569-74641591 CTGGGGAAGGGGAGGTGGGTGGG - Intergenic
1151561108 17:74870156-74870178 TTGTGGAATGGGATGGGGAGGGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151850749 17:76688215-76688237 CTGGGTGATGGGAAGTGGTGGGG + Intronic
1152132468 17:78485420-78485442 GTGGGGCATGGGAAGTGAGGAGG + Intronic
1152150784 17:78599670-78599692 CTGTGAGATTGGAGGTGGGGGGG - Intergenic
1152720185 17:81919770-81919792 CAGGGGAAGGGGAAGAGGGGTGG + Exonic
1152755391 17:82084998-82085020 GTGGGGAAGGGGAAGTGGTGAGG + Intronic
1152770227 17:82163042-82163064 CTGAGGAAGGGGCTGTGGGGAGG - Intronic
1153583942 18:6602323-6602345 CTGTGGAATAGAAAGTGCTGTGG + Intergenic
1153807041 18:8717724-8717746 CTGTAGAATGGGAGGGGAGGGGG + Intronic
1155173923 18:23286882-23286904 CTTTGGATTGGGAAGAAGGGCGG - Intronic
1155417156 18:25611422-25611444 CTGGGGAAGGGGAAATGAGGAGG + Intergenic
1155696921 18:28695996-28696018 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1155988355 18:32254222-32254244 CTTTGGAAGGCCAAGTGGGGTGG + Intronic
1156376353 18:36518725-36518747 CTGTGGGATGTGGACTGGGGAGG + Intronic
1156465061 18:37343532-37343554 GGGTGGGATGGGAGGTGGGGAGG - Intronic
1156829936 18:41479677-41479699 CTGGGGAGTGGGAATAGGGGTGG + Intergenic
1157132127 18:45016804-45016826 CCGGGGAATAGGAGGTGGGGAGG - Intronic
1158396439 18:57081858-57081880 CGGGGGAGTGGGGAGTGGGGTGG + Intergenic
1159835154 18:73327468-73327490 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1160211247 18:76881982-76882004 GTGTGTAATGGGAAATGGTGAGG - Intronic
1160227446 18:77021940-77021962 CTGGGGGATGCGAAGAGGGGAGG + Intronic
1160377770 18:78426782-78426804 CTCTGGGATGGGTAGGGGGGAGG + Intergenic
1160577184 18:79863483-79863505 CGGAGGAGTGGGAAGTGGGCGGG + Intergenic
1161197163 19:2993409-2993431 CTAGGTAATGGGCAGTGGGGAGG - Intronic
1161307336 19:3575343-3575365 CCGGGGCATGGGAAGTGAGGTGG + Intronic
1161515009 19:4691579-4691601 GTGTGGCACGGGAAGGGGGGCGG + Intronic
1161706464 19:5824393-5824415 CAGTGGAGTGGGAGGTGGTGGGG + Intronic
1162034026 19:7929636-7929658 CTCTGGCCTGGGAAGTGGGATGG + Intronic
1162450817 19:10753410-10753432 AAGGGGAAAGGGAAGTGGGGGGG - Intronic
1162795635 19:13086162-13086184 GTTTGGAATGGGAAGTGCAGAGG + Intronic
1162826096 19:13253144-13253166 GTGGGAAGTGGGAAGTGGGGAGG + Intronic
1162913487 19:13862324-13862346 CCGTGGAGTGGGAGGTGGCGGGG + Intronic
1162917360 19:13881567-13881589 TCGTGGAGGGGGAAGTGGGGAGG + Intergenic
1162964105 19:14147919-14147941 CTGGGGCGTGGGAGGTGGGGAGG + Exonic
1163090269 19:15014643-15014665 GTGTTGACTGGGGAGTGGGGAGG + Intronic
1163462573 19:17448018-17448040 GTGGGGAGAGGGAAGTGGGGAGG + Intronic
1163632819 19:18425841-18425863 CTACGGAAAGGCAAGTGGGGGGG - Intronic
1163633411 19:18428036-18428058 CTGTGGCTGGGGAGGTGGGGTGG + Intronic
1163742250 19:19022624-19022646 CTGTGGGAGGGTAAGTGGGTGGG + Intronic
1163849808 19:19656510-19656532 CTGTGGACTGGGGAGCCGGGTGG - Intronic
1164153074 19:22571072-22571094 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1164245149 19:23421958-23421980 CTGGGGTATGGGGAGTAGGGAGG - Intergenic
1164290199 19:23861383-23861405 CTGTGTGGTGGGTAGTGGGGGGG - Intergenic
1164459124 19:28432746-28432768 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1164573654 19:29392503-29392525 CTGTGGGCAGGGAAGTGGGTGGG + Intergenic
1164707298 19:30329395-30329417 CTGGGGAATGGGAGGTGGGGAGG + Intronic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165428375 19:35757791-35757813 CTGTTGCAGGGGCAGTGGGGCGG - Intronic
1165496910 19:36158305-36158327 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1165510227 19:36262374-36262396 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1165835457 19:38752438-38752460 CTTTGGATTGGGAAGAAGGGCGG - Intronic
1166288211 19:41845285-41845307 CTGGGGCACGGGAAGGGGGGAGG + Intronic
1166295377 19:41886870-41886892 CTGTGGAAAGAGGGGTGGGGTGG - Intronic
1166438697 19:42791583-42791605 TTGTGCTATGGGAAGAGGGGAGG + Intronic
1166487656 19:43227437-43227459 TTGTGCTATGGGAAGAGGGGAGG + Intronic
1166494491 19:43289309-43289331 TTGTGCTATGGGAAGAGGGGAGG + Intergenic
1166498838 19:43326389-43326411 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1166822028 19:45586461-45586483 CTGTAAAATGGGAAGGGGGCTGG - Intronic
1166844904 19:45721411-45721433 GTGGGGATGGGGAAGTGGGGTGG - Intronic
1166966481 19:46532151-46532173 CTGTGCAGTGGGAAGTAGGCGGG - Intronic
1167359622 19:49023317-49023339 CTGCGGAATGGGGTGTGGGAGGG - Intronic
1167361509 19:49032768-49032790 CTGCGGAATGGGGTGTGGGAGGG + Intronic
1167362145 19:49036017-49036039 CTGCGGAATGGGGTGTGGGAGGG - Intronic
1167363939 19:49044841-49044863 CTGCGGAATGGGGTGTGGGAGGG + Intronic
1167364559 19:49048086-49048108 CTGCGGAATGGGGTGTGGGAGGG - Intronic
1167365844 19:49054722-49054744 CTGCGGAATGGGGTGTGGGAGGG - Intronic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1168051739 19:53834430-53834452 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1168063924 19:53908959-53908981 CTGAGGCCTGGGAAGTGGAGAGG - Intergenic
1168114791 19:54216226-54216248 CTTTGGGAGGGCAAGTGGGGAGG - Intronic
925084557 2:1097845-1097867 GTGGTGAAAGGGAAGTGGGGCGG - Intronic
925340606 2:3132786-3132808 CTTTGGAAGGGAAAGTGGGGAGG + Intergenic
925413847 2:3655997-3656019 CAGTGGAATGGGGCGGGGGGAGG + Intergenic
925544654 2:5003810-5003832 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
926413694 2:12629330-12629352 CTTTGGATTGGGAAGAAGGGAGG - Intergenic
926537831 2:14135173-14135195 CAGTGGGAGGGGTAGTGGGGTGG + Intergenic
926872422 2:17437075-17437097 TTGGGGAGTGGGAGGTGGGGTGG + Intergenic
927199343 2:20568696-20568718 GTGTGGAATGGGATGTGGCCTGG - Intronic
927636883 2:24823029-24823051 CTGGGGAAGGGGAGGTGAGGTGG - Intronic
928193832 2:29198433-29198455 CTGTTGGATGGGAAGTGGAGGGG - Intronic
928194038 2:29201443-29201465 CTGTTGGATGGGAAGTGGAGGGG - Intronic
928827557 2:35439982-35440004 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
929568646 2:43006230-43006252 CTGGGAAATGGAAGGTGGGGTGG + Intergenic
930638353 2:53830029-53830051 CTGTGGAATGGTGAGAGGAGTGG - Intergenic
930886427 2:56332062-56332084 GGGTGGGATGGGAGGTGGGGTGG + Intronic
931042714 2:58316522-58316544 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
931356105 2:61538520-61538542 GTGGGGGAGGGGAAGTGGGGAGG + Intronic
931471275 2:62539944-62539966 CTGTAGAATGAGAAGAGGGGAGG + Intergenic
931608840 2:64078062-64078084 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
931625881 2:64255361-64255383 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
931948357 2:67334429-67334451 CTTTGGATTGGGAAGAAGGGAGG - Intergenic
932197311 2:69795916-69795938 TTGTGCTATGGGAAGAGGGGAGG + Intronic
932306208 2:70705697-70705719 CTGTGGGATGGGGTGTGGGAAGG - Intronic
932313101 2:70759906-70759928 CTGTGGTATGGTCAGTGGGGTGG - Intronic
932447008 2:71787397-71787419 GGGTGGAATGGGGAGGGGGGCGG - Intergenic
932572155 2:72943758-72943780 CTCTGGACTGGGAAGGGGGCAGG - Exonic
932785229 2:74595256-74595278 CTGTGGGAGGCCAAGTGGGGAGG - Intronic
932818719 2:74881773-74881795 GTTCGGAATGGGAAGTGGGGTGG + Exonic
932854109 2:75216654-75216676 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
932973849 2:76576731-76576753 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
933123808 2:78577069-78577091 CTGTGGGGTGGGGAGAGGGGGGG + Intergenic
933770791 2:85742638-85742660 CAGTGGAATGTGATTTGGGGAGG + Intergenic
935287879 2:101581266-101581288 GTGTGACATGGGAACTGGGGAGG + Intergenic
935593017 2:104857724-104857746 CTCTGAAATGGGAAGGAGGGGGG + Exonic
936595167 2:113840533-113840555 CTGTGGAATGGGCAGTTTTGGGG + Intergenic
936883432 2:117281564-117281586 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
937018889 2:118632903-118632925 CTAGGGAATGGGAGGTGGGGAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938055735 2:128213400-128213422 CCGTAGGAGGGGAAGTGGGGAGG - Intergenic
938428355 2:131210318-131210340 CTGTGGAAGGGGTGGTTGGGGGG + Intronic
938646854 2:133340441-133340463 TTGTGGAATGGAAAGAGAGGAGG - Intronic
938773820 2:134523732-134523754 CAGAGAAACGGGAAGTGGGGAGG + Intronic
938835095 2:135094175-135094197 CTGGGAAATGGGATTTGGGGAGG - Intronic
939065740 2:137481722-137481744 CTGGGGAGTGGGATGTGGGTTGG - Intronic
939307506 2:140428965-140428987 CTTTGGATTGGGAAGAAGGGTGG - Intronic
939848364 2:147274996-147275018 TTGTGGCCTGGGAAGTGTGGGGG - Intergenic
939962586 2:148578469-148578491 GTGGGGAGTGGGCAGTGGGGAGG + Intergenic
940424677 2:153516856-153516878 CTGTGTAAAGAGAAGTGGGAAGG - Intergenic
940451355 2:153842119-153842141 CTGTGGGATGGGGAGGTGGGGGG + Intergenic
940931073 2:159432203-159432225 CTGTGGAATGAGGAGAGGGAAGG + Intronic
940980373 2:159994933-159994955 CTGTGGTGTGGGATGTGGGGTGG + Intronic
940989844 2:160086050-160086072 TTGTGCTATGGGAAGAGGGGAGG + Intergenic
941935796 2:170980521-170980543 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
942579413 2:177401421-177401443 CTGTGAAATGGGCAGTTGTGAGG - Intronic
942730191 2:179054638-179054660 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
943412831 2:187563368-187563390 CTTTGGATTGGGAAGAAGGGCGG + Intronic
943757201 2:191569151-191569173 CTGTGGGAGGGGGAGAGGGGAGG + Intergenic
945048353 2:205801176-205801198 GTGTGAGATGGGGAGTGGGGTGG + Intergenic
945153000 2:206809735-206809757 CTTTGGACTGGGAAGAAGGGTGG + Intergenic
945183288 2:207113592-207113614 AAGTGGAATGGGGGGTGGGGGGG + Intronic
945284197 2:208065822-208065844 CTGTGGAAAGGCGGGTGGGGAGG + Intergenic
945780977 2:214172237-214172259 GTGGGGTAGGGGAAGTGGGGAGG - Intronic
945938425 2:215925204-215925226 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
947223602 2:227819067-227819089 CAGAGGAAAGGGAGGTGGGGTGG + Intergenic
947523569 2:230865601-230865623 CTGGGGAATTGGGGGTGGGGGGG + Intronic
948955592 2:241287922-241287944 CTGTAGAATGTGAAGACGGGAGG + Intronic
949062989 2:241972155-241972177 CTGTGGCCTGGGAAGGTGGGTGG + Intergenic
1168756264 20:320398-320420 CTGTTGAATTGGAAGAGGAGGGG - Intergenic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169762932 20:9116238-9116260 CTGGGGAATGTGAAATGGAGTGG - Intronic
1169923817 20:10762078-10762100 CTGTGCCATGGGATGTGGGCTGG - Intergenic
1170165843 20:13359790-13359812 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1170325388 20:15150710-15150732 CTTTGGATTGGGAAGAAGGGCGG + Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1171112691 20:22498879-22498901 CTGTGGACTATGAAGTGGGGAGG + Intergenic
1171244457 20:23600212-23600234 CAGTGTCTTGGGAAGTGGGGTGG - Intergenic
1171381424 20:24737137-24737159 CTGGGGTATGGGGAGTGGGAAGG - Intergenic
1172049843 20:32109162-32109184 CTGTGAAATGGGAAGGGGGTTGG - Intergenic
1172088888 20:32412800-32412822 CTTTGGAATGGCAAGGCGGGAGG - Intronic
1172771279 20:37384069-37384091 CTGTGGAATGGGTGGGAGGGAGG + Intronic
1173102011 20:40096171-40096193 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1173241464 20:41301266-41301288 ATGGAGAATGGGTAGTGGGGAGG - Intronic
1173464712 20:43271712-43271734 CCGTGGCATGGGATGTGGGGTGG + Intergenic
1173963711 20:47094783-47094805 CTGTGGGAGGCCAAGTGGGGAGG + Intronic
1174125234 20:48299559-48299581 TTGTGGGATGGGAAGAGGAGGGG - Intergenic
1174222799 20:48970700-48970722 CTCCGGCATGGGCAGTGGGGAGG + Intronic
1174734562 20:52953432-52953454 ATGTGGATTGAGAAGTGGGTTGG - Intergenic
1174858343 20:54067751-54067773 CTGTTGAATGGGAGGGGGGGTGG + Intronic
1175813122 20:61869604-61869626 GTGTGGAATGGGAAGTCAGCGGG - Intronic
1176065779 20:63193873-63193895 TTGTGGAGTGAGAATTGGGGGGG - Intergenic
1176298422 21:5086630-5086652 ATGGGGCAGGGGAAGTGGGGTGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177113002 21:17050902-17050924 CTGTGGGGAGGGAAGTGAGGTGG + Intergenic
1177662561 21:24105115-24105137 CTGTGAGGTGGGCAGTGGGGAGG + Intergenic
1177817808 21:25997321-25997343 CTGAGGGAAGGGAAGAGGGGAGG - Intronic
1178001292 21:28164031-28164053 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1178727839 21:35070660-35070682 TTGTGGAGTGGAAAGTGGGAGGG + Intronic
1179015181 21:37589890-37589912 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1179150226 21:38803574-38803596 CTTTGGAAGGGGAAATAGGGAGG + Intergenic
1179153829 21:38832449-38832471 CTGTGGCTTGGGAATAGGGGAGG + Intergenic
1179557991 21:42192958-42192980 CTGTCTAATGGGGGGTGGGGTGG - Intergenic
1179810547 21:43866375-43866397 CTGGGGGCTGGGAGGTGGGGCGG + Intronic
1179858604 21:44175319-44175341 ATGGGGCAGGGGAAGTGGGGTGG - Intergenic
1180144736 21:45912849-45912871 GTGGGGAAGGGGATGTGGGGCGG - Intronic
1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG + Intergenic
1181625436 22:24119495-24119517 CTGTGGGATGGGAAGAAGAGAGG + Exonic
1181775235 22:25154499-25154521 GGGTGGATTGGGAAATGGGGTGG + Intronic
1182732375 22:32505600-32505622 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1183341969 22:37286537-37286559 GTGGGGAATGGGAAGGGGTGGGG + Intronic
1183358687 22:37372396-37372418 CTTCGGAAAGGGATGTGGGGTGG + Exonic
1184017290 22:41795682-41795704 GTGTGGAATGGGCACTGAGGAGG + Intronic
1184028528 22:41876581-41876603 CTGTAAAATGGAGAGTGGGGTGG + Intronic
1184272779 22:43394095-43394117 CAGTGGGTTGGGAAGAGGGGTGG + Intergenic
1184291158 22:43498799-43498821 GTGTGGATTGGGTGGTGGGGTGG - Intronic
1184557032 22:45239151-45239173 GTGTGGACAGGGGAGTGGGGAGG + Intronic
1184685948 22:46096419-46096441 CTGTGGGATGGGAAGAGGGTCGG + Intronic
1184726521 22:46350545-46350567 CTGGAGAAGGGGAAGTGGTGCGG - Intronic
1184995729 22:48206026-48206048 CTCTGGATTGGGAAGAGGGGTGG + Intergenic
1185013758 22:48331771-48331793 CTGAGGGATGGGAAGAGAGGAGG + Intergenic
949671255 3:6400507-6400529 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
949673729 3:6428645-6428667 GTGGGGTAGGGGAAGTGGGGAGG - Intergenic
950895803 3:16449832-16449854 TTGTGGAAAGGGATGTGAGGAGG + Intronic
952515797 3:34103902-34103924 CAGTGGACTCAGAAGTGGGGAGG + Intergenic
952833877 3:37588322-37588344 AGATGGAAAGGGAAGTGGGGGGG - Intronic
953974499 3:47371811-47371833 CTGTGGCAGGAGAAGTGGGGAGG - Intergenic
954412463 3:50376798-50376820 CTGTGGAAGGGGGAGAGGTGTGG - Intronic
954415873 3:50393026-50393048 CTGGGGGATGGGGACTGGGGAGG + Intronic
954461551 3:50629757-50629779 CTGGGGGATGGGAAGAGTGGAGG - Intronic
954805642 3:53218367-53218389 CTGGGGTCTGGGAAGTGAGGAGG + Intergenic
955251121 3:57283440-57283462 CTGGGAAATGAGAAGTGTGGTGG + Intronic
955953366 3:64264048-64264070 TTGTGGAGTGGGGGGTGGGGTGG - Intronic
956117099 3:65929838-65929860 CTGTGGAATGGAGAGTGGGCTGG + Intronic
956488390 3:69745451-69745473 CAGAGGAAGGGGAACTGGGGAGG + Intronic
956548899 3:70437744-70437766 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
956709313 3:72025820-72025842 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
957050987 3:75411783-75411805 CTGGGGAAGGGGGCGTGGGGAGG + Intergenic
957317206 3:78586025-78586047 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
957821816 3:85386369-85386391 CTGGAGAATGGGAATTGGGTGGG + Intronic
957857215 3:85894345-85894367 GTGGGGTAGGGGAAGTGGGGAGG + Intronic
958182983 3:90083892-90083914 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
959288253 3:104442796-104442818 CTTTGGACTGGGAAGAAGGGTGG + Intergenic
959434394 3:106296399-106296421 CCGTGTAATAGGAAGTGGGTAGG - Intergenic
959693664 3:109226408-109226430 ATGTGGAGTGGGAAGTAGGTGGG + Intergenic
959972163 3:112420443-112420465 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
961545823 3:127632267-127632289 CTGTGGCATGGCAGGCGGGGAGG - Intronic
962326876 3:134441758-134441780 CTGGGGAAGGGGAGGTGGGGAGG - Intergenic
963520536 3:146356379-146356401 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
963663443 3:148154479-148154501 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
963684434 3:148417176-148417198 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
964067992 3:152600275-152600297 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
964125357 3:153229571-153229593 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
964209935 3:154215338-154215360 TAGGGGAGTGGGAAGTGGGGAGG - Intronic
964213376 3:154252702-154252724 GTGTGGGAAGGGAAGTGGGGAGG + Intronic
964310526 3:155386953-155386975 CTGGGAAAAGGGAAGTGGGGAGG + Intronic
964394237 3:156228800-156228822 CTGTGGAAGGAGAAATAGGGTGG - Intronic
965262554 3:166503664-166503686 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
965624789 3:170675405-170675427 CTTTGGATTGGGAAGAAGGGCGG + Intronic
966105703 3:176330816-176330838 CTTATGAATGGCAAGTGGGGTGG - Intergenic
966688669 3:182722793-182722815 TTGTGCTATGGGAAGAGGGGAGG + Intergenic
967495079 3:190134130-190134152 CTTTGGTTTGGAAAGTGGGGGGG - Intergenic
967496324 3:190147332-190147354 CTTTGGATTGGGAAGAAGGGAGG - Intergenic
967624550 3:191669366-191669388 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
967975884 3:195034660-195034682 CTTTGGAAGGGGAACCGGGGAGG + Intergenic
968673077 4:1862700-1862722 CTGGGGAGTGGGGGGTGGGGGGG + Intergenic
968876047 4:3268550-3268572 CTGCTGAATGGGGCGTGGGGAGG + Intronic
969064920 4:4471149-4471171 CTGAGGACTGGGAATTGGCGAGG + Intronic
969470862 4:7388546-7388568 CTGTGGGTGGGGAAGCGGGGAGG - Intronic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
970087639 4:12366594-12366616 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
970191598 4:13523707-13523729 CTGCCGAGAGGGAAGTGGGGTGG + Intergenic
970394260 4:15650059-15650081 CTGGGGGATGGGTAGTGGGGTGG - Intronic
971123086 4:23724906-23724928 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
971200234 4:24503839-24503861 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
971917564 4:32893025-32893047 GTGTGGAATGGGAAATCAGGGGG - Intergenic
972110830 4:35557209-35557231 CTGTGGAAGTGGAAGTGGTATGG - Intergenic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
973791800 4:54384947-54384969 CTGAGGACAGGGTAGTGGGGAGG - Intergenic
975369439 4:73567977-73567999 CTGTGGAAAGGGGAGGGAGGAGG - Intergenic
975694479 4:76998280-76998302 CTGTGAAATGGAAATGGGGGTGG - Intronic
975748823 4:77501709-77501731 ATGTGGAATGGTAAGTGGTGGGG - Intergenic
975933791 4:79556859-79556881 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
976147202 4:82053653-82053675 CTGTGCTCTGGGATGTGGGGAGG - Intergenic
976532819 4:86174640-86174662 CTGTGGAAAGAGAAGTGTTGAGG - Intronic
976696640 4:87924692-87924714 CTTTGGATTGGGAAGAAGGGAGG - Intergenic
977012826 4:91657504-91657526 CTTTGGATTGGGAAGAAGGGAGG + Intergenic
977058535 4:92225183-92225205 CTGTTGAATAGGAAGGAGGGAGG + Intergenic
977075105 4:92441848-92441870 CTTTGGATTGGGAAGAAGGGAGG + Intronic
977198333 4:94087516-94087538 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
977931914 4:102758869-102758891 CAGTGGAATGAGAAATGGGAAGG - Intronic
978001019 4:103556645-103556667 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
978336807 4:107678035-107678057 GTGTGGCTTGGGGAGTGGGGAGG + Intronic
979380038 4:119996750-119996772 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
980061783 4:128138540-128138562 TTGTGGAAAGGGTAGTGGTGGGG + Intronic
980072556 4:128259347-128259369 CTGTGCAGTGGGAACTGGTGAGG + Intergenic
980098477 4:128517989-128518011 GTGTGGAATGGGAAGTGAAAGGG - Intergenic
980285037 4:130770190-130770212 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
980389026 4:132121024-132121046 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
980472346 4:133266574-133266596 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
980527962 4:134014994-134015016 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
980904035 4:138930692-138930714 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
981089897 4:140721628-140721650 CTGTGGAATCTGAAGTAGGTAGG - Intronic
981197418 4:141937948-141937970 GTGTGGAATGGGAAATCAGGGGG + Intergenic
981539820 4:145835574-145835596 CTTTGGATTGGGAAGAAGGGCGG - Intronic
981600328 4:146481232-146481254 ATTTGGACTGGGGAGTGGGGTGG - Intronic
981681779 4:147407835-147407857 CTGTGGTTTAGGAGGTGGGGAGG - Intergenic
981689341 4:147489668-147489690 CTGTGGCATGGAAGGTGGGATGG + Intronic
982088974 4:151864126-151864148 CTGTGGATTGGGAGGAGAGGTGG - Intergenic
982535543 4:156603109-156603131 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
983062467 4:163174893-163174915 TTGTGCTATGGGAAGAGGGGAGG - Intergenic
983345656 4:166523351-166523373 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
983360505 4:166719129-166719151 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
983528870 4:168789270-168789292 CTGTGCAATGGGAAGAGTTGGGG + Intronic
984393516 4:179167776-179167798 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
984441709 4:179779297-179779319 CTGTGGAAAGGGGAGTGTGGGGG - Intergenic
985389769 4:189482345-189482367 CTTTGGATTGGGAGGAGGGGCGG + Intergenic
985582446 5:705614-705636 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
985676639 5:1234841-1234863 CTGTGGCATGGGCAGTGGCCCGG + Intronic
985855537 5:2421721-2421743 CTGTGGAAGAGGGAGTGGTGGGG - Intergenic
986280339 5:6316998-6317020 CTGGGGATTGGGGAGTGGGAGGG - Intergenic
986388977 5:7266412-7266434 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
986554950 5:9001428-9001450 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
987312004 5:16690323-16690345 CAGTGGGGTGGGGAGTGGGGTGG + Intronic
987722556 5:21657226-21657248 CTGTGGAATAGAAAATGTGGAGG + Intergenic
987924847 5:24327360-24327382 CTGTTGAATGATAAGTTGGGAGG - Intergenic
988727569 5:33939308-33939330 ATGTGCAAGGGGAATTGGGGCGG + Intergenic
989487164 5:42004781-42004803 CTGTAGAATGGGCGGTGGTGAGG + Intergenic
989624920 5:43420134-43420156 CTGAGGAAGGAGGAGTGGGGCGG - Intergenic
990429425 5:55719608-55719630 CTGGGGAAGCTGAAGTGGGGGGG - Intronic
990888502 5:60621533-60621555 CTGGGGTAGGGGGAGTGGGGAGG + Intronic
991198194 5:63960284-63960306 CCGTGGAGCAGGAAGTGGGGAGG + Intergenic
991481943 5:67090342-67090364 GGGGGGAAGGGGAAGTGGGGAGG - Intronic
992101881 5:73415962-73415984 CTAAGCAATGGGAAGTGGTGAGG - Intergenic
992394764 5:76360183-76360205 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
993192815 5:84701304-84701326 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
993270568 5:85791049-85791071 GTGGGGTAGGGGAAGTGGGGAGG - Intergenic
993836794 5:92826788-92826810 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
994313258 5:98301729-98301751 CTGTGGAGAAGAAAGTGGGGGGG + Intergenic
994436592 5:99742976-99742998 CACTAGAATGGGTAGTGGGGAGG - Intergenic
994532446 5:100987140-100987162 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
994731173 5:103492408-103492430 CTTTTGAATGGGAGATGGGGTGG + Intergenic
994767245 5:103934257-103934279 ATGTGCATTGGGAAGTGGGGTGG - Intergenic
995122602 5:108552101-108552123 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
995440506 5:112186678-112186700 CTGAGTAATGGGTAGTGTGGCGG + Intronic
995468485 5:112475432-112475454 ATAGGGAAGGGGAAGTGGGGTGG + Intergenic
995645477 5:114306449-114306471 CTATGTAATTGGAGGTGGGGTGG + Intergenic
995759527 5:115548667-115548689 CTGAGGAATGGGATGTGGAATGG + Intergenic
996745341 5:126842440-126842462 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
997249957 5:132380920-132380942 CTGGGGAGAGGGGAGTGGGGAGG + Intronic
997307847 5:132852628-132852650 GGGTGGAATGGCAAGTGGAGTGG - Intergenic
997600482 5:135135189-135135211 CTGGGGCATGGGACGTGTGGTGG - Intronic
997767863 5:136523368-136523390 CTTTGGAATGGGAAATTTGGGGG + Intergenic
997769584 5:136542494-136542516 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
998179389 5:139925869-139925891 CTGTGGAGTGGGTAGAGAGGTGG - Intronic
999177248 5:149640099-149640121 TTGGGAAATGGGAAGTGGGATGG + Intergenic
999208511 5:149867864-149867886 ATTTGGAATTGCAAGTGGGGTGG - Intronic
999618768 5:153452591-153452613 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1000124231 5:158227711-158227733 CTGTGGGGTGGGGGGTGGGGAGG - Intergenic
1000438679 5:161242796-161242818 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1000990012 5:167902160-167902182 GAGTGGAGTGGGGAGTGGGGTGG + Intronic
1001225328 5:169940013-169940035 CTGGGGAATGGGAGGTGTTGGGG - Intronic
1001428041 5:171637373-171637395 CTGTGCAATAGGGAGTGGTGAGG - Intergenic
1001543977 5:172558703-172558725 GTGTGGAAGGGGAACTGGGTGGG - Intergenic
1001811184 5:174629469-174629491 GCCTGGAATGGGAAGTGGGCTGG + Intergenic
1002055075 5:176594101-176594123 CTGTGGACTGGGAAGGGGCAGGG + Intronic
1002173373 5:177387664-177387686 CTGGGGACTGGGACGTGGGTGGG + Intronic
1002636270 5:180610263-180610285 CTCTGTGATGGGAAGTGAGGGGG + Intronic
1003430078 6:6030674-6030696 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1004271219 6:14197483-14197505 CTGTGGAAGGGGAAGAAGTGTGG + Intergenic
1004317173 6:14599725-14599747 CTGAGGAAGGAGAGGTGGGGAGG + Intergenic
1004507896 6:16261875-16261897 CTTTGGATTGGGAAGAAGGGCGG + Intronic
1004837102 6:19541731-19541753 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1004845177 6:19633896-19633918 GTGTGGAAAGGGAGGTGGGATGG + Intergenic
1005014556 6:21364389-21364411 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1005281792 6:24282484-24282506 CTTTGGGATGCCAAGTGGGGAGG - Intronic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1006101209 6:31687470-31687492 CTAAGGAGTGGGAAGTGGGAAGG - Intronic
1006263988 6:32901301-32901323 ATGTGGCATGAGAAATGGGGCGG - Intergenic
1006302152 6:33199373-33199395 CTGGGGAAGGGGATTTGGGGAGG + Exonic
1006355385 6:33553719-33553741 CTGAGGAATTGGAAGTGGTTGGG - Intergenic
1006844000 6:37050304-37050326 CCGAGGAAGGGGAAGTGGCGGGG - Intergenic
1006889951 6:37418185-37418207 CGGAGGAATGGGAAGGGGAGAGG + Intergenic
1008509646 6:52264303-52264325 GTGTGGGATGGGAAGTAGGGCGG + Exonic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1008860110 6:56138831-56138853 ATGTGGTAGAGGAAGTGGGGAGG + Intronic
1010586596 6:77663437-77663459 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1010829597 6:80513188-80513210 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1011770840 6:90673094-90673116 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1012014290 6:93832960-93832982 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1012066443 6:94556826-94556848 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1012315926 6:97782427-97782449 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1013407789 6:109858647-109858669 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1013744877 6:113333787-113333809 CTTTGGAATCTGAAGTGAGGTGG + Intergenic
1013830821 6:114270603-114270625 CTCTGGAATGGGATGCAGGGAGG + Intronic
1013864700 6:114681195-114681217 CTAGGGTATGGGAAGTGGTGAGG + Intergenic
1013891804 6:115034708-115034730 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1014001965 6:116374279-116374301 TTGGGGAAGGGGCAGTGGGGTGG - Intronic
1014217653 6:118768082-118768104 ATGTGCAATGGGGAGTGCGGGGG - Intergenic
1014258331 6:119186603-119186625 CTGTGGTCTGGGAAGTGCTGGGG - Intronic
1014360066 6:120465165-120465187 CTTTGGATTGGGAAGAAGGGAGG + Intergenic
1014454770 6:121623321-121623343 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1014555948 6:122842652-122842674 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1014718995 6:124894866-124894888 CTTTGGATTGGGAAGAAGGGAGG - Intergenic
1014793889 6:125704747-125704769 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1015340255 6:132090908-132090930 GTGTGAAATGGGAGGTGGAGAGG + Intergenic
1015438238 6:133215970-133215992 CTGTGGGTTGGGAAGATGGGAGG - Intergenic
1015630105 6:135223440-135223462 ATGTGGAGTGGGCAGAGGGGAGG - Intergenic
1015715575 6:136188924-136188946 TTGAGGGTTGGGAAGTGGGGTGG + Intronic
1016283962 6:142451795-142451817 CTGAGGAAGGGGTAGTGGGGAGG - Intergenic
1016342036 6:143073028-143073050 CACGGGAGTGGGAAGTGGGGAGG - Intronic
1017389603 6:153924313-153924335 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1017737747 6:157380341-157380363 CTGTCGGGTGGGAAGGGGGGAGG + Intergenic
1018074595 6:160200671-160200693 CTGTGGGAAGAGAGGTGGGGAGG - Intronic
1018203466 6:161415772-161415794 CAGTGAAATGGGCAGTGGCGGGG - Intronic
1018554965 6:165039658-165039680 CTGTGGAGTGGCAAGGGGTGAGG + Intergenic
1018965520 6:168484937-168484959 CTGGGGAAGGGGAAATGGGGAGG + Intronic
1019206550 6:170366408-170366430 AAGGGGAATGGCAAGTGGGGAGG + Intronic
1019357354 7:587630-587652 CTGTGGAAGGGGCTGTGTGGTGG - Intronic
1019502256 7:1370121-1370143 CTTTGGACAGGGCAGTGGGGAGG + Intergenic
1019653251 7:2172253-2172275 CTGTTGAATGGGAAGGGTCGTGG - Intronic
1020317303 7:6914947-6914969 CTGGGGAAGGGGGGGTGGGGAGG + Intergenic
1021810757 7:24399095-24399117 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1021977797 7:26027079-26027101 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1022023709 7:26426303-26426325 CTGAGGAAAGGGAAGTGGTAGGG - Intergenic
1022041672 7:26587637-26587659 TAGTGGGATGGGAAGTGTGGAGG - Intergenic
1023169997 7:37381711-37381733 CTATGGACTGGGAAGAGGTGTGG - Intronic
1023347467 7:39286130-39286152 CTGGGAAGTGGGAAGTGGGGAGG + Intronic
1023698789 7:42873499-42873521 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1025238106 7:57248483-57248505 GTGTGGGGTGGGGAGTGGGGAGG + Intergenic
1027052125 7:75027231-75027253 CTGTGACATGGGACGTGGGAAGG + Intronic
1027233924 7:76286864-76286886 CTGTGGTCTGGGACGTGGGCTGG + Exonic
1028344415 7:89761635-89761657 GTGTGGGCTGGGAAGTGGGCAGG - Intergenic
1028651251 7:93152528-93152550 GTGGGGATTGGGAAGGGGGGGGG + Intergenic
1029693446 7:102197763-102197785 CTGCGGGGTGGGAAGAGGGGAGG - Intronic
1030110997 7:106026855-106026877 CTGGAGAATGGGAAGGGTGGGGG + Intronic
1030441586 7:109594908-109594930 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1031124249 7:117755849-117755871 CTGTTGAATGGGATGTGGGCAGG + Intronic
1031401044 7:121326890-121326912 AAGGGGAATTGGAAGTGGGGAGG - Intronic
1031525692 7:122819750-122819772 CTTTGGATTGGGAAGAAGGGTGG - Intronic
1031532071 7:122886950-122886972 AGGTGGAATGGGGAGCGGGGAGG + Intergenic
1031776418 7:125912817-125912839 CTTTGGATTGGGAAGAAGGGAGG - Intergenic
1033066814 7:138163927-138163949 GTGTGCATTGGGAAGTGGGATGG + Intergenic
1033675848 7:143540108-143540130 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1033695986 7:143789335-143789357 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1034071684 7:148192046-148192068 CTGAGGAGTGGGAAGTGGGGAGG + Intronic
1034819572 7:154204322-154204344 CTCCTGGATGGGAAGTGGGGAGG + Intronic
1035084616 7:156247449-156247471 CAGTGGACTGGGAAGTGGCAGGG - Intergenic
1035274757 7:157741112-157741134 CTGTGGAAGGAGGCGTGGGGTGG - Intronic
1035490471 7:159272261-159272283 TTGTGATATGGGAAGTGGGCAGG + Intergenic
1035880570 8:3241098-3241120 CTTTGGATTGGGAAGAAGGGCGG + Intronic
1036281579 8:7405264-7405286 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1036339891 8:7906308-7906330 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1036908592 8:12731453-12731475 CAGTGGAATGGGAAATAGAGAGG - Intronic
1037089774 8:14899559-14899581 CTGTGCAGTGGGAAGTGTGAAGG - Intronic
1037116534 8:15236100-15236122 CTGGGCAAAGGGAAGTAGGGAGG - Intronic
1037727666 8:21496391-21496413 CTGTGGAAAGGGAAGTGTGCAGG + Intergenic
1038433119 8:27515695-27515717 CTGTGGAAGGGAAAGAGGAGAGG - Intronic
1038627330 8:29206844-29206866 TTGCGGAAGTGGAAGTGGGGTGG + Intronic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1039396801 8:37233039-37233061 CTTTGGAGTGGGGAGAGGGGTGG - Intergenic
1040547392 8:48409279-48409301 CTGTGTTATGGTAAGTGGGAAGG - Intergenic
1040599329 8:48869211-48869233 CAGTGGACGGGGAAGTGGGAAGG + Intergenic
1040607654 8:48950748-48950770 GTCTGGGATGGGAAATGGGGAGG - Intergenic
1040978358 8:53219010-53219032 CTGTGGAGAGGTGAGTGGGGAGG + Intergenic
1041707594 8:60862945-60862967 CTGTGGAATAGGATGTATGGTGG + Intronic
1041920656 8:63179668-63179690 TTGTGGAATAGAAAGGGGGGAGG - Intronic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1042214722 8:66418728-66418750 CTGTTGAATGGTAAGTTGGCTGG - Intergenic
1042487801 8:69365928-69365950 CTATAAAATGGGCAGTGGGGAGG - Intergenic
1044820691 8:96153997-96154019 CAGTGGGCTGGGAAGTGGAGTGG + Intronic
1044925261 8:97203743-97203765 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1045197625 8:99946698-99946720 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1045291804 8:100839901-100839923 CTGTGGGGTGGGGAATGGGGAGG + Intergenic
1045644881 8:104288760-104288782 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1046512181 8:115215053-115215075 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1047002557 8:120587400-120587422 GTGGGGAATGGGTAGTGGGTTGG - Intronic
1047699446 8:127434556-127434578 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1048019809 8:130527859-130527881 GTGGGGAATGGGGAGTGGGAGGG + Intergenic
1048143857 8:131822017-131822039 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1048168335 8:132083119-132083141 CTTTGGATTGGGAAGAAGGGTGG + Intronic
1048349433 8:133604114-133604136 CTGGAGGATGAGAAGTGGGGTGG - Intergenic
1048728327 8:137411159-137411181 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1048764143 8:137827709-137827731 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1049868723 8:144957146-144957168 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1049917705 9:334473-334495 GTGAGGTGTGGGAAGTGGGGAGG + Intronic
1050258008 9:3814051-3814073 CTTTGGATTGGGAAGAAGGGTGG + Intergenic
1050532792 9:6605399-6605421 CTGTGGGACGGGATGTGGGCAGG - Intronic
1051052726 9:12951150-12951172 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1051262010 9:15273714-15273736 CAGTGGAATGGAATGTTGGGTGG - Intronic
1052166696 9:25339279-25339301 TTCTGGGATGGAAAGTGGGGTGG + Intergenic
1052982173 9:34457837-34457859 GTCTGGGATGGGAGGTGGGGAGG - Intronic
1052992101 9:34524514-34524536 CTGGGTAATGGGCAGTGGGGGGG - Intergenic
1054766374 9:69045830-69045852 GTGTGCAAGGGCAAGTGGGGGGG + Intronic
1054807391 9:69407634-69407656 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1055233168 9:74088488-74088510 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1055594047 9:77847632-77847654 CTTGGGAATGAAAAGTGGGGAGG + Intronic
1055626821 9:78183636-78183658 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1055881839 9:81011836-81011858 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1056061253 9:82886574-82886596 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1056323987 9:85461471-85461493 CTTTGGATTGGGAAGAAGGGAGG - Intergenic
1056522548 9:87413751-87413773 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1056883076 9:90415401-90415423 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1057216199 9:93230199-93230221 CTGGGGAGTGGGGAGTGGGGTGG + Intronic
1057218125 9:93240701-93240723 CGGTGGAATGGGAATTGTGTGGG + Intronic
1057234947 9:93350434-93350456 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1057314071 9:93958024-93958046 CTGTGGAATGGGGTGAGGGCTGG - Intergenic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058593751 9:106592905-106592927 CAGTGGAATTGGAAGAGGCGTGG + Intergenic
1059336123 9:113569399-113569421 CTGTGGAATGGGAGGTGGCATGG + Intronic
1059751969 9:117256138-117256160 ATGCGGAATGGGGAGTGGGAAGG + Intronic
1059771938 9:117434851-117434873 AAGTGGAAGGGGAAGTGAGGAGG + Intergenic
1059863390 9:118488553-118488575 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1059891933 9:118813556-118813578 CTGGGGAAGAGGGAGTGGGGCGG - Intergenic
1060006357 9:120003539-120003561 CTCTGGATTAGGAAGTGGGAAGG - Intergenic
1060405030 9:123368832-123368854 CTGAGGCTGGGGAAGTGGGGAGG - Intronic
1060586771 9:124791253-124791275 CTGGGTAATGGAAAGTGGGGTGG + Intronic
1060669655 9:125458666-125458688 TTGTGGAATAGAAAGGGGGGAGG - Intronic
1060728594 9:126022633-126022655 ACGTGGAATAGGAAGAGGGGAGG + Intergenic
1060737786 9:126077510-126077532 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1060785622 9:126449848-126449870 TTGTAAAATGGGAAGTGGAGTGG - Intronic
1061506016 9:131032243-131032265 CTGTGGGGTGGGGGGTGGGGGGG + Intronic
1061571294 9:131478939-131478961 CTCAGGAATGAGGAGTGGGGAGG - Intronic
1062021582 9:134322056-134322078 CTGTGCCATGAGAAGCGGGGAGG + Intronic
1062180670 9:135189427-135189449 CTGTGGCATGGGGTGTGGTGTGG - Intergenic
1062631051 9:137463340-137463362 CTGTGGCAGGGGCCGTGGGGCGG + Intronic
1062698420 9:137887015-137887037 CCAGGGAATGGGAAGTGTGGAGG + Intronic
1062716668 9:138013984-138014006 ATGGGGAATGGGAGGTGTGGGGG - Intronic
1185858330 X:3556015-3556037 CTCTGGATTGGGAAGAAGGGCGG + Intergenic
1187128348 X:16475686-16475708 CTGTGGAGGGGGAAGTTAGGAGG + Intergenic
1187560213 X:20395581-20395603 GTGTAGGATGGGAGGTGGGGAGG + Intergenic
1188066006 X:25660179-25660201 CTGGGGAATGGGCAGAGTGGTGG + Intergenic
1188200866 X:27292025-27292047 CTTTGGGATGGGAAGAAGGGTGG + Intergenic
1188419594 X:29978164-29978186 CTTTGGACTGGGAAGAAGGGCGG - Intergenic
1188463286 X:30451984-30452006 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1188574658 X:31632340-31632362 CTGTGGAATTGTAAGTGTGTAGG + Intronic
1189416205 X:40816594-40816616 CTGTTGAATGGAAAGTGGGATGG - Intergenic
1192317828 X:70066202-70066224 CTGTGGACTGGGACACGGGGTGG + Intergenic
1192451877 X:71249918-71249940 CTGTGGAAAGGGGAGTGGGGAGG - Intronic
1193136653 X:77979073-77979095 CTTTGGAAGGTGAAGGGGGGCGG - Intronic
1193360320 X:80572953-80572975 ATTCGGAATGGGAAGTGGAGTGG - Intergenic
1193953883 X:87835072-87835094 CTGGGGATTGGGAAGTCAGGTGG + Intergenic
1194035310 X:88863868-88863890 GTGTGGAGGGGGAAGTGTGGAGG + Intergenic
1194382493 X:93211922-93211944 GTGTGGAGGGGGCAGTGGGGTGG - Intergenic
1195688299 X:107604266-107604288 CTGTGGATCGGGGAGGGGGGTGG + Exonic
1195753101 X:108176738-108176760 CCTAGGAATGGGAAATGGGGAGG - Intronic
1195853025 X:109303734-109303756 TTGTGGAAAGGGAAGTAGGCAGG + Intergenic
1196073183 X:111546748-111546770 CTTTGGATTGGGAAGAAGGGAGG - Intergenic
1196149201 X:112353682-112353704 GTGGGGTATGGGGAGTGGGGAGG + Intergenic
1196165644 X:112533440-112533462 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1196300106 X:114042812-114042834 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1196330921 X:114469588-114469610 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1196341617 X:114604183-114604205 CTTTGGATTGGGAAGAAGGGCGG + Intronic
1196375148 X:115025518-115025540 ATGTGGAATTGGAAGGGGGGTGG - Intergenic
1196512156 X:116524322-116524344 CAGTGGACTGGGAAGGTGGGTGG - Intergenic
1196533450 X:116815369-116815391 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1196572598 X:117281979-117282001 CTTTGGATTGGGAAGAAGGGCGG - Intergenic
1197063628 X:122212843-122212865 TGGGGGAAGGGGAAGTGGGGAGG + Intergenic
1197267634 X:124392467-124392489 CTGTGGAATGTGAAGCCGTGAGG - Intronic
1197351958 X:125391729-125391751 CTTTGGATTGGGAAGAAGGGCGG + Intergenic
1197407585 X:126071145-126071167 CTGAGGAGTGGGAAGAAGGGAGG + Intergenic
1197747348 X:129940505-129940527 TTGTTGAAAGGGATGTGGGGTGG - Intergenic
1197981989 X:132226955-132226977 CTGGGGAATGAGAAGTTTGGAGG + Intergenic
1198021159 X:132659388-132659410 CCTAAGAATGGGAAGTGGGGAGG - Intronic
1198065619 X:133093735-133093757 CTTTGGAAGGCCAAGTGGGGTGG + Intronic
1198599305 X:138267202-138267224 CTTTGGACTGGGAAGAAGGGCGG + Intergenic
1198738333 X:139812374-139812396 CTTTGTAAAGGGGAGTGGGGTGG + Intronic
1198756024 X:139983454-139983476 CTGTGGAAATGAAAGTGTGGAGG + Intergenic
1199576572 X:149318486-149318508 CTTTGGATTGGGAAGAAGGGTGG - Intergenic
1199601507 X:149543962-149543984 CAGTGGAGTGGGTGGTGGGGGGG + Intronic
1199648870 X:149935522-149935544 CAGTGGAGTGGGTGGTGGGGGGG - Intronic
1200102866 X:153696721-153696743 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200267872 X:154655501-154655523 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1201107252 Y:10772388-10772410 CAATGGAATGGAAAGTGGAGGGG - Intergenic
1201458929 Y:14201326-14201348 ATAAGGAAGGGGAAGTGGGGAGG + Intergenic
1201620834 Y:15955772-15955794 CTGTGTAATGTGAAATGTGGAGG + Intergenic
1202627119 Y:56871089-56871111 CCGTGGAAGGGGAGGAGGGGTGG - Intergenic