ID: 1141587450

View in Genome Browser
Species Human (GRCh38)
Location 16:85044270-85044292
Sequence TAGAGTCCCTGCACACACAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141587450_1141587458 24 Left 1141587450 16:85044270-85044292 CCGCTGTGTGTGCAGGGACTCTA 0: 1
1: 0
2: 2
3: 9
4: 132
Right 1141587458 16:85044317-85044339 TCCCCTGTGTCATCTAGGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 141
1141587450_1141587456 19 Left 1141587450 16:85044270-85044292 CCGCTGTGTGTGCAGGGACTCTA 0: 1
1: 0
2: 2
3: 9
4: 132
Right 1141587456 16:85044312-85044334 GAGTGTCCCCTGTGTCATCTAGG 0: 1
1: 0
2: 0
3: 19
4: 209
1141587450_1141587452 -10 Left 1141587450 16:85044270-85044292 CCGCTGTGTGTGCAGGGACTCTA 0: 1
1: 0
2: 2
3: 9
4: 132
Right 1141587452 16:85044283-85044305 AGGGACTCTAGTCCCCAGGAAGG 0: 1
1: 0
2: 11
3: 74
4: 246
1141587450_1141587457 20 Left 1141587450 16:85044270-85044292 CCGCTGTGTGTGCAGGGACTCTA 0: 1
1: 0
2: 2
3: 9
4: 132
Right 1141587457 16:85044313-85044335 AGTGTCCCCTGTGTCATCTAGGG 0: 1
1: 0
2: 0
3: 18
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141587450 Original CRISPR TAGAGTCCCTGCACACACAG CGG (reversed) Intronic
903889772 1:26561641-26561663 TGGAGTATCTGCACTCACAGGGG + Exonic
906199607 1:43950928-43950950 CAGAGTCCCTGTCCTCACAGAGG - Intronic
912274203 1:108239575-108239597 GGGACTTCCTGCACACACAGAGG - Intronic
912287064 1:108380287-108380309 GGGACTTCCTGCACACACAGAGG + Intronic
912294016 1:108454748-108454770 GGGACTTCCTGCACACACAGAGG + Intronic
912455755 1:109795839-109795861 TTGGGTCCCTGCACTCACAGGGG + Intergenic
916572796 1:166041816-166041838 TACAGTCCCTGGACACATACAGG + Intergenic
917514747 1:175698134-175698156 TAGTGTCCCTGCCCACACACTGG - Intronic
920391496 1:205606005-205606027 TAGACTCCCTGCAGTTACAGGGG + Intronic
922223078 1:223623543-223623565 TTGGGCCCCTGCACACACACTGG + Intronic
923033947 1:230271183-230271205 TTCCGTCCCTGCACTCACAGGGG - Intronic
924381709 1:243471440-243471462 TAGAGTTCAGGCAGACACAGAGG - Intronic
1065135887 10:22669647-22669669 GAGAGGCCATGCACACTCAGAGG + Intronic
1066336248 10:34481277-34481299 AGGAGTCCCTGAACACACACTGG - Intronic
1066476212 10:35749638-35749660 TAGAATCCCTGCAGATTCAGAGG - Intergenic
1068734805 10:60400885-60400907 CAGAGTCACTTCACACACTGGGG - Intronic
1070890956 10:79941960-79941982 TGGAGTCCCTGGAAACACAGGGG - Exonic
1076502090 10:130945341-130945363 TAGTGTAGCTGCACACTCAGTGG + Intergenic
1076511069 10:131013780-131013802 TAGAGTCACTGTCCACAGAGTGG + Intergenic
1078291940 11:10020376-10020398 TAGGCTCTCTGCATACACAGTGG - Intronic
1078387431 11:10904787-10904809 TAGAGTGGCTGCACTCTCAGTGG + Intergenic
1083452548 11:62755513-62755535 GAGAGTCTCTACACACCCAGAGG + Intergenic
1084488572 11:69465327-69465349 CAGTGTCCCAGCACACACACAGG + Intergenic
1085486951 11:76872455-76872477 TAAAGTCCCTGGACTCACTGGGG - Intronic
1091273229 11:134332301-134332323 TAGAGTGCCTGCAGCCGCAGGGG - Intronic
1091351653 11:134902622-134902644 AAGTGTCCATGCACACACACTGG + Intergenic
1097601170 12:61694843-61694865 TTGAGTCCATGCACACCCCGGGG + Intergenic
1098148236 12:67519622-67519644 TGTAATCCCTGCACACACATTGG + Intergenic
1101880996 12:108625631-108625653 TAGAGTCTCTGAATAGACAGTGG - Intronic
1103551491 12:121740955-121740977 TAGAGTCCCAGCACAGCCACAGG + Intronic
1103837916 12:123838696-123838718 GGGAGCCCCTGCACACCCAGAGG - Intronic
1107478512 13:40764405-40764427 TACAGAACCTGCACATACAGAGG + Intronic
1108846223 13:54680344-54680366 CAGATTCCCTCCACACACAAGGG - Intergenic
1110670389 13:78170001-78170023 GAGAGCACCTGCACGCACAGTGG - Intergenic
1114264639 14:21066145-21066167 TAGTGACCCTGCAGCCACAGTGG - Intronic
1121010369 14:90516841-90516863 TCAAGTCCCAGCACACACATGGG - Intergenic
1124651295 15:31476242-31476264 TCCAGCCCCTGTACACACAGAGG - Exonic
1125345490 15:38714798-38714820 CAGACCCCCTGCAAACACAGGGG + Intergenic
1126838792 15:52695604-52695626 ATGAGTCCCTGCACACTCATAGG - Intronic
1128218351 15:65949915-65949937 TAGACTTCCTGCTCACACGGGGG - Intronic
1129718984 15:77867419-77867441 GGGCCTCCCTGCACACACAGTGG + Intergenic
1130459943 15:84153441-84153463 GGGCATCCCTGCACACACAGTGG - Intergenic
1131777942 15:95822869-95822891 TAATGTCCCTGCACAGTCAGGGG - Intergenic
1132589400 16:720127-720149 TAGAGCCCCTGCAGGGACAGAGG - Intronic
1136251803 16:29010151-29010173 TATAGTCCCAGCACTCTCAGAGG + Intergenic
1138554363 16:57763157-57763179 AACAGTCCCTGCCCCCACAGAGG - Intronic
1140723361 16:77789842-77789864 TACAGTGCCCGCACACAGAGAGG - Intronic
1141587450 16:85044270-85044292 TAGAGTCCCTGCACACACAGCGG - Intronic
1141642676 16:85350425-85350447 TAGGGTCCCTGAAGTCACAGGGG - Intergenic
1141699157 16:85634557-85634579 TGGTGTCCCTGGAAACACAGTGG + Intronic
1143012552 17:3873888-3873910 AACAGCCCCTGCCCACACAGAGG + Intronic
1144039266 17:11394097-11394119 TATGGTCCTTGCTCACACAGGGG - Intronic
1146926158 17:36747233-36747255 CAGAGTCCCTGCACTTACACAGG + Intergenic
1148951935 17:51321005-51321027 TGGATTCCCAGCACTCACAGAGG + Intergenic
1149050651 17:52300621-52300643 CATAGTACCTGAACACACAGTGG + Intergenic
1151063675 17:71126054-71126076 TGGAGTCCCAACACACACTGAGG + Intergenic
1151160235 17:72158955-72158977 CACAGTCCACGCACACACAGGGG - Intergenic
1151519432 17:74617645-74617667 TGGTGTCCCTGCTCTCACAGGGG - Intronic
1152444649 17:80334594-80334616 GAGAGTTCCTGCCCACAGAGAGG + Intronic
1153896144 18:9562687-9562709 AAGAGTACCTGCACACACTGGGG - Intronic
1156682682 18:39609922-39609944 TGGAACCCCTGCACACATAGTGG - Intergenic
1157852113 18:51064441-51064463 TACAGTCCCTGTTCTCACAGAGG - Intronic
1163195701 19:15718021-15718043 CAGTGTCCCTGCAGCCACAGAGG - Intergenic
1166662797 19:44658096-44658118 TACACTCCCTCCACACACACAGG + Intronic
926782103 2:16482766-16482788 TAGAGACCCTGGCCACACTGAGG - Intergenic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
929897721 2:45976286-45976308 CCGAGTCCCTCCACACACAAAGG + Intronic
931018998 2:58021304-58021326 TGGAGTCCATACACACTCAGTGG - Intronic
934218032 2:90052373-90052395 TAGGTTCCCTCCAAACACAGAGG + Intergenic
935194905 2:100807494-100807516 TTGAGACCCTGCACTCCCAGAGG + Intergenic
935706271 2:105860345-105860367 TAGAGTTCCTGCATCCACAAGGG + Intronic
938291164 2:130151342-130151364 CAGAGTCCCTGAGCACACGGGGG - Intergenic
938402303 2:131004029-131004051 TAGAGCCCCTGCACACCCTGGGG + Intronic
938465377 2:131521617-131521639 CAGAGTCCCTGAGCACACGGGGG + Intergenic
939993891 2:148902146-148902168 CACAGTCACTGCACAGACAGGGG - Intronic
942539331 2:176999052-176999074 TATAGTCCCTGCTAACAAAGTGG - Intergenic
942891314 2:180992501-180992523 GATAGTCCCTGGACCCACAGTGG - Intronic
946820954 2:223628617-223628639 TAAAGTACCTTCACACACATGGG + Intergenic
1168849043 20:964069-964091 TGGAGCCCCTGCACACACAATGG - Exonic
1169847920 20:10015589-10015611 TAGAGGCACTGCACAGAGAGGGG - Intronic
1171486309 20:25489030-25489052 CATGGTCCCTGGACACACAGAGG + Intronic
1173186347 20:40843360-40843382 TCAAGGCCCTGCACACACAGGGG + Intergenic
1173743480 20:45419088-45419110 TTGGGGGCCTGCACACACAGGGG - Intronic
1173968170 20:47129694-47129716 TAGTGGCCCAGCACACAGAGGGG + Intronic
1174664542 20:52245717-52245739 TAGAGTCTGTGCCCACAAAGAGG + Intergenic
1179425123 21:41270653-41270675 TATATTCCCTGCCCACACTGAGG - Intronic
1179583114 21:42357287-42357309 ATGGGTGCCTGCACACACAGTGG - Intergenic
1181177950 22:21048316-21048338 GAGAGTCCTTCCACACAGAGAGG + Intronic
1184192159 22:42902064-42902086 TCGTGGCCCTTCACACACAGTGG - Intronic
950580082 3:13856174-13856196 TGGTGTCCCTGCTAACACAGAGG + Intronic
952067940 3:29594900-29594922 TAGAGTCCTTGCAAAAGCAGAGG - Intronic
952605153 3:35137828-35137850 CAGAGACCCTGCCTACACAGAGG + Intergenic
952770095 3:36992373-36992395 TAGAGTCCCTGCAGACAGCAGGG - Exonic
954845521 3:53552153-53552175 TACAGCCCCTCCACACACACTGG - Intronic
964404373 3:156333148-156333170 TGGAGTAAATGCACACACAGTGG + Intronic
968761391 4:2444212-2444234 TAGACTCACTGCCCACTCAGGGG + Intronic
969500403 4:7549133-7549155 TTGTGTCCCTGCATCCACAGAGG + Intronic
973965243 4:56155244-56155266 GAGAGTCAGTGGACACACAGTGG + Intergenic
976384297 4:84437627-84437649 TAGAGTCCTTGATCACCCAGAGG + Intergenic
979231970 4:118356240-118356262 GAGTCTCCCTGCACACACAACGG + Intergenic
980350680 4:131680292-131680314 TAGACTGACTGCACACAGAGAGG - Intergenic
982583201 4:157204901-157204923 TACAGGCCCCGCACACACACGGG - Intronic
982775964 4:159441649-159441671 TAGAATACAAGCACACACAGAGG - Intergenic
984169321 4:176342596-176342618 TTCAGTCACTGCACACACTGAGG + Intergenic
985176564 4:187209014-187209036 TAGAGTTCCTGTAGAAACAGGGG - Intergenic
985726115 5:1516498-1516520 TGGTGTCCATGCACAGACAGTGG - Intronic
986804840 5:11300069-11300091 TGGAGTCCCTGCACCCCCAGAGG - Intronic
988792876 5:34624622-34624644 AAGAGGCCCTGGACAGACAGGGG + Intergenic
989499805 5:42152229-42152251 TACAGTCCATGAACACACGGAGG - Intergenic
990393654 5:55354723-55354745 CAGAGTCCCTGCTAGCACAGAGG - Intronic
1002419021 5:179135911-179135933 TGCAGTCCCCGCGCACACAGAGG + Exonic
1003143166 6:3488394-3488416 CAGAGTGCCTGCACACACAGGGG - Intergenic
1007366529 6:41398030-41398052 GAGAGTCCCTGCACCCACCATGG + Intergenic
1011591416 6:88973881-88973903 TAGAGTCCCATCTCACATAGAGG + Intergenic
1018638098 6:165882821-165882843 TAGAGGCCCTGGAAACACACTGG - Intronic
1018663073 6:166106181-166106203 TACATTCTGTGCACACACAGAGG + Intergenic
1018918130 6:168150710-168150732 TAGAGTCCCCGGAGCCACAGAGG + Intergenic
1019131771 6:169882260-169882282 TGGAGTTCCTGCACTCACAGAGG + Intergenic
1019934311 7:4244385-4244407 TCGAGTCCCTGCACACCCTTCGG + Intronic
1022605022 7:31804453-31804475 TAGTTTCCCTTTACACACAGAGG + Intronic
1024005231 7:45220239-45220261 CAGAGTGCCTGCAAACCCAGTGG - Intergenic
1034530204 7:151691075-151691097 TCAATTCCCTGCAGACACAGAGG - Intronic
1034835373 7:154346634-154346656 CAGAGTCCCTCAAGACACAGGGG - Intronic
1035029094 7:155845580-155845602 TGCAGTCCCTGGACAAACAGAGG - Intergenic
1036595089 8:10204921-10204943 TGCAGTCCCTGTACAAACAGTGG + Intronic
1037894112 8:22640611-22640633 TAGAGATCCAGAACACACAGGGG + Intronic
1037922100 8:22814687-22814709 TAAAGTCTCTGCAGACAGAGAGG - Intronic
1039470381 8:37809772-37809794 TTGCCTCCCAGCACACACAGAGG + Intronic
1040994989 8:53392212-53392234 TAGAGACCACACACACACAGGGG + Intergenic
1044550867 8:93511109-93511131 TAGAGCCCATGCACACACAGGGG - Intergenic
1046207037 8:111014622-111014644 TAGAGTCACAGAACACACAAAGG - Intergenic
1047881342 8:129197137-129197159 TAGAGTCAATGAATACACAGGGG + Intergenic
1048366241 8:133741040-133741062 TGGTGTCCCTGGACATACAGAGG + Intergenic
1051482325 9:17574315-17574337 TAAAGACCCTGCACTCAAAGAGG + Intergenic
1058702857 9:107615059-107615081 TGGATTCCCTCCCCACACAGAGG + Intergenic
1060745807 9:126130228-126130250 CAGAGTGCGTGCACACACTGGGG - Intergenic
1062395956 9:136352934-136352956 TTGAGTGCGTGCACACACACAGG - Intronic
1062731058 9:138109495-138109517 TTCTCTCCCTGCACACACAGAGG - Intronic
1187210338 X:17224248-17224270 TAGAGTCTCTTCTCACAGAGAGG + Intergenic
1191234888 X:58126398-58126420 TAGAATCCCTGCAGTCACACAGG - Intergenic
1193717128 X:84945950-84945972 TAGAACCCCCACACACACAGTGG + Intergenic
1196733510 X:118964084-118964106 GCAAGGCCCTGCACACACAGAGG - Intergenic
1198964073 X:142208764-142208786 GAGACTCCCTGCCCACAAAGAGG - Intergenic
1200165771 X:154034140-154034162 TAGAGCCACTGCATACACAAAGG + Intronic