ID: 1141590095

View in Genome Browser
Species Human (GRCh38)
Location 16:85062755-85062777
Sequence CCAGCCCGGTGCTACCATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141590095_1141590101 -2 Left 1141590095 16:85062755-85062777 CCCAAATGGTAGCACCGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1141590101 16:85062776-85062798 GGCTCTGAGCAGGGACAGTGTGG 0: 1
1: 0
2: 2
3: 52
4: 364
1141590095_1141590102 9 Left 1141590095 16:85062755-85062777 CCCAAATGGTAGCACCGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1141590102 16:85062787-85062809 GGGACAGTGTGGCTCCTTGCTGG 0: 1
1: 1
2: 1
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141590095 Original CRISPR CCAGCCCGGTGCTACCATTT GGG (reversed) Intronic
906159072 1:43634337-43634359 CCAGCAATGTGCTAACATTTTGG - Intergenic
908416562 1:63918544-63918566 CAAGCTCTGTGCTCCCATTTGGG + Intronic
920104009 1:203537656-203537678 CAAGCATGGTGCTACCATCTTGG - Intergenic
920279502 1:204832021-204832043 TCAGCCCTGAGCTACCATTCCGG - Intronic
924389910 1:243543153-243543175 ACAGCCAGGAGCTACCATGTGGG - Intronic
1073475270 10:103748480-103748502 CCAGCACAGTGCCAGCATTTGGG - Intronic
1081154980 11:39679537-39679559 CCAGTCTGGTACTACCATTCAGG + Intergenic
1085076452 11:73597106-73597128 CCATCCCTGTCCTCCCATTTCGG + Intronic
1092228184 12:6762501-6762523 CTAGCCCAGTGGCACCATTTTGG - Intronic
1093594502 12:20944729-20944751 ACAGCCCGGTGCTACACCTTGGG - Intergenic
1100201363 12:92301133-92301155 CCAGACCGAAGATACCATTTAGG - Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1103975357 12:124699192-124699214 CCTGCCTGGTGCTAACATTCTGG + Intergenic
1104692899 12:130839681-130839703 CCAGCCCTGGGATACCATTCTGG + Intergenic
1104775272 12:131387139-131387161 CCCGCCCAGTGCTGCCCTTTAGG - Intergenic
1114299688 14:21363973-21363995 CCAGCCAAGAGCTACAATTTGGG + Intronic
1119103865 14:71906030-71906052 CCAGCAGGGAGCTACTATTTTGG - Intergenic
1126336872 15:47594746-47594768 CCTTCCCTGTGCTCCCATTTTGG - Intronic
1128725004 15:69981961-69981983 GCAGCCAGGAGCAACCATTTTGG - Intergenic
1132764811 16:1528982-1529004 CCTGCCCGGGGCTACCATCTCGG - Intronic
1134254928 16:12602964-12602986 CCAGCCCAGGGCTCCCATGTAGG + Intergenic
1135716993 16:24779914-24779936 CCAGCCCTGGGCTGCCATTTTGG + Intronic
1137565899 16:49532367-49532389 CCACCACGCTGCTCCCATTTTGG + Intronic
1141049403 16:80746953-80746975 CCAGCCAGTTGTTACCATATTGG - Intronic
1141590095 16:85062755-85062777 CCAGCCCGGTGCTACCATTTGGG - Intronic
1146895385 17:36537140-36537162 CCAGCACGGTGGTTCCATTGAGG - Exonic
1148860718 17:50603010-50603032 CCAGCCCAGTGCCACCACCTGGG - Exonic
1155035479 18:22021750-22021772 CCAGCCCAGTGCTAGCATTTTGG - Intergenic
1157166939 18:45366367-45366389 CCAGCCAGGTGCTACCAGGTGGG + Intronic
1158348213 18:56537420-56537442 CTAGCCTGGTTCTACCACTTAGG + Intergenic
1163675254 19:18652619-18652641 CCAGCCCAGTGCTGCCACCTGGG + Intronic
1164638694 19:29810194-29810216 TTAGCCCAGTGCTGCCATTTTGG + Intergenic
1164712744 19:30369392-30369414 CGAGCCCTGTGCTACCATTCTGG - Intronic
927885161 2:26713732-26713754 CCAGGCTGGTGGTACGATTTTGG - Intronic
930572622 2:53106471-53106493 CAACCCAGGTGATACCATTTTGG + Intergenic
936593189 2:113822936-113822958 CCAGCATGGTGCTAATATTTGGG - Intergenic
940184970 2:150974065-150974087 TCAGTTTGGTGCTACCATTTTGG - Intergenic
941737655 2:168997044-168997066 CAAGCCCTGGGCTGCCATTTAGG - Intronic
946048435 2:216840702-216840724 CCTGACAGGTGCTACCAATTTGG + Intergenic
1170788606 20:19489629-19489651 CCAGCCAGGAACTACAATTTGGG + Intronic
1174126252 20:48309180-48309202 CCAGCCCACTGCTACCACTGTGG + Intergenic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1177852298 21:26363043-26363065 CCATCCTGGTCATACCATTTTGG - Intergenic
1178266757 21:31150077-31150099 GTAGCCCAATGCTACCATTTGGG + Intronic
1179783550 21:43717675-43717697 CCAGCCTCGTGGTACCATCTAGG + Intergenic
1181060993 22:20281954-20281976 CCAGCCCCCTGCTGCCATGTGGG - Intronic
1182473988 22:30565900-30565922 CCAGGCAGGTGTCACCATTTAGG + Intronic
954104519 3:48402778-48402800 GCAGCCAGGTGCCATCATTTGGG - Intergenic
956079677 3:65544746-65544768 CTGGCCCGGTGCTATCAGTTAGG - Intronic
959539863 3:107525222-107525244 CCGGCCCGGCGCTGCCATTCCGG - Intronic
968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG + Intronic
968916222 4:3498094-3498116 GCAGCCCGACGCTACCACTTGGG - Intronic
978980946 4:114944841-114944863 CCACCCCGGTGCTGCATTTTTGG + Intronic
982765335 4:159340877-159340899 CCAGCCCTGTGTTCCCATTTTGG + Intronic
1002879595 6:1238967-1238989 CCAGCCCAGTGCCACCCTCTTGG + Intergenic
1021145761 7:17086885-17086907 CTAGCTTTGTGCTACCATTTTGG + Intergenic
1024388254 7:48778148-48778170 CCAGCCTGGTACTGCCATCTAGG - Intergenic
1028229191 7:88286548-88286570 CCAGCCCTGAGTTATCATTTTGG - Intronic
1034147967 7:148888975-148888997 CCAGCTCACTGCTACCACTTTGG - Intergenic
1041636071 8:60146486-60146508 TCAGCCCAGTGATACCCTTTTGG - Intergenic
1046818034 8:118606956-118606978 CCAGCCAGGTGGTACCATGAGGG - Intronic
1046906799 8:119582290-119582312 CTAGCCAGTAGCTACCATTTTGG + Intronic
1048277888 8:133080851-133080873 CCAACCCAGTGCTAACATCTAGG + Intronic
1049050223 8:140188830-140188852 CCAGCCTGGTGGTATCAATTCGG - Intronic
1049790947 8:144472510-144472532 CCCGCCCCGTGCTTCCACTTGGG + Intronic
1053300799 9:36948076-36948098 CCAGCTCTGTGCTAGCATATCGG + Intronic
1058506282 9:105669500-105669522 CCAGCCTGGTGCTCCCAAATAGG - Intergenic
1059667793 9:116465349-116465371 CCAGCCAGTTGCTCCCATTCTGG - Intronic
1061318219 9:129810931-129810953 CCAGCCCGGTGCTGCCACAAAGG - Exonic
1062491399 9:136806860-136806882 CCAGCCCGGGGCTACCTCCTCGG - Exonic
1186217811 X:7318726-7318748 CATGCCTGGTGCTACCATTCAGG + Intronic
1190274078 X:48889218-48889240 CCATCCCGGTGGGCCCATTTAGG - Intergenic
1193018728 X:76766323-76766345 CCAGCCAATTGCTACCATGTAGG + Intergenic
1194040391 X:88934827-88934849 CAAGCCAGGTAATACCATTTTGG - Intergenic
1197326498 X:125100924-125100946 CTAGCTATGTGCTACCATTTTGG - Intergenic
1197916844 X:131544684-131544706 TCACCCTGCTGCTACCATTTGGG + Exonic