ID: 1141592323

View in Genome Browser
Species Human (GRCh38)
Location 16:85077224-85077246
Sequence GGGGGCACTCACGGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141592312_1141592323 14 Left 1141592312 16:85077187-85077209 CCTGCTCCTAGTGGCTTCTCAGT 0: 1
1: 0
2: 1
3: 22
4: 233
Right 1141592323 16:85077224-85077246 GGGGGCACTCACGGGGAGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 187
1141592313_1141592323 8 Left 1141592313 16:85077193-85077215 CCTAGTGGCTTCTCAGTGCACAG 0: 1
1: 0
2: 3
3: 37
4: 422
Right 1141592323 16:85077224-85077246 GGGGGCACTCACGGGGAGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 187
1141592309_1141592323 19 Left 1141592309 16:85077182-85077204 CCCTCCCTGCTCCTAGTGGCTTC 0: 1
1: 0
2: 1
3: 47
4: 337
Right 1141592323 16:85077224-85077246 GGGGGCACTCACGGGGAGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 187
1141592311_1141592323 15 Left 1141592311 16:85077186-85077208 CCCTGCTCCTAGTGGCTTCTCAG No data
Right 1141592323 16:85077224-85077246 GGGGGCACTCACGGGGAGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 187
1141592310_1141592323 18 Left 1141592310 16:85077183-85077205 CCTCCCTGCTCCTAGTGGCTTCT 0: 1
1: 0
2: 1
3: 39
4: 266
Right 1141592323 16:85077224-85077246 GGGGGCACTCACGGGGAGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141592323 Original CRISPR GGGGGCACTCACGGGGAGCA GGG Intronic
900165253 1:1241918-1241940 CGGGGCACCCAGGTGGAGCAGGG - Intergenic
900470970 1:2854795-2854817 GGGAGCACCCACGGTGTGCAGGG + Intergenic
900766288 1:4508002-4508024 GGGGTCACTCACAGGGACGATGG + Intergenic
902382720 1:16060164-16060186 GGGGGCACTGATGGAGATCATGG - Intronic
902454329 1:16521139-16521161 GGGTCCCCTCGCGGGGAGCAGGG + Intergenic
902669153 1:17960603-17960625 GAGGGCACAAATGGGGAGCATGG - Intergenic
904842741 1:33383894-33383916 GGAAGGACTCAGGGGGAGCATGG + Intronic
905177233 1:36144964-36144986 TGGGGCACTAACGGGAAGAAAGG - Intronic
906102171 1:43270783-43270805 GGGGGAACTCACGAGAAGCCTGG - Exonic
906197094 1:43936173-43936195 GGGGGCCTTCGCGGGGGGCAGGG - Exonic
913228429 1:116720812-116720834 GGTGGCACACACTGGGAGCATGG - Intergenic
914006471 1:143736475-143736497 GGGTCCCCTCGCGGGGAGCAGGG + Intergenic
914176967 1:145287262-145287284 GGTCCCCCTCACGGGGAGCAGGG - Intergenic
914516579 1:148379451-148379473 GGGTCCCCTCGCGGGGAGCAGGG + Intergenic
916051741 1:161041312-161041334 AGGGTCACTCACGGGGAATAAGG + Exonic
920709850 1:208285037-208285059 AGGGGCGCTCACGGGCAGCCTGG + Intergenic
921409845 1:214823728-214823750 GGGGGCAGTTGCAGGGAGCATGG - Intergenic
922502946 1:226110268-226110290 GGGGGAACTGCCGGGGAGCCGGG - Intergenic
922766486 1:228158956-228158978 GCGGGCACTGTCGGGGAGCAGGG + Exonic
922767999 1:228165986-228166008 GGGGCCACGCACGCGCAGCAGGG - Exonic
924641374 1:245836694-245836716 GAGAGCACTCACTGGCAGCAGGG + Intronic
1063869830 10:10405313-10405335 GGTGGCACACAAGGAGAGCATGG + Intergenic
1067582980 10:47457186-47457208 GGGGCCACTCATGGGGAGACAGG + Intergenic
1070786045 10:79162803-79162825 GTGGGTCCTCAGGGGGAGCAGGG - Intronic
1072221235 10:93329377-93329399 GGGCTCAATGACGGGGAGCAAGG + Intronic
1072930242 10:99656225-99656247 AGGGGCACTCAGGAGGGGCATGG + Intergenic
1073603234 10:104867247-104867269 GGGAGAACTCACTGGAAGCAGGG + Intronic
1075118983 10:119651057-119651079 GGCGGCAGGCACGGGGAGCACGG + Intergenic
1076065438 10:127444405-127444427 GGGGACACTCCCAGGGAGCCAGG - Intronic
1076702893 10:132283448-132283470 GGATGCACTCACTGGGAGGAGGG + Intronic
1083477470 11:62923470-62923492 GGGGGCACTCAGGAGGAGGCAGG - Intergenic
1083757978 11:64801673-64801695 GGGGGCACTCCTGGGGAGGGAGG - Intronic
1084940815 11:72612022-72612044 GGAGGCACAGATGGGGAGCAAGG + Intronic
1086158396 11:83693826-83693848 GGGACCAATCACTGGGAGCAGGG + Intronic
1087224250 11:95580271-95580293 GGGGACACACACGGGGAGTGGGG - Intergenic
1089151186 11:116365664-116365686 TGGGGCACTCAGGGTGAGGATGG - Intergenic
1089470284 11:118715204-118715226 GGGGGCAGTCACTGTGTGCAGGG - Intergenic
1091192873 11:133708827-133708849 GGGAGCAGCCACGAGGAGCAAGG - Intergenic
1091404095 12:198135-198157 GGGCGCACTCACGGAGAGTTGGG - Intronic
1092086410 12:5766541-5766563 GGAGGCACTAATGGAGAGCATGG + Intronic
1092906069 12:13101478-13101500 GGGGGCCCTCCCAGAGAGCAGGG + Intronic
1097500719 12:60397634-60397656 TGGGGCACACAAGAGGAGCATGG + Intergenic
1098486315 12:71025895-71025917 GGGAGCACACACTGGCAGCATGG + Intergenic
1102570975 12:113826845-113826867 GGGGGCTCTTACGCGGAGCCTGG + Intronic
1102980542 12:117237536-117237558 GGGGACACTCGGGGGGAGAAGGG - Intronic
1103894407 12:124263643-124263665 GGGTCCACTCAGGGGGACCAGGG + Intronic
1104425855 12:128677635-128677657 GGGGGCACCCAGGGGGCACAGGG - Intronic
1113881051 13:113626529-113626551 GGGAGCACACACGGGGAGGGGGG - Intronic
1118735206 14:68696200-68696222 GGGAGCACTCACGAGGTGCCAGG - Intronic
1121757729 14:96417078-96417100 TGGGCCAGTCACAGGGAGCAAGG + Intronic
1122774574 14:104111591-104111613 GGGGGCACTCACGACGTGCAGGG - Exonic
1124342645 15:28900149-28900171 GGGAGGACCCACGGGGCGCAGGG - Intronic
1125709664 15:41774629-41774651 GGGGGCGCTGACGAGTAGCAGGG + Intronic
1127097380 15:55526715-55526737 GAGAGCACTGACAGGGAGCATGG - Intergenic
1127281523 15:57497358-57497380 GGGGGCAGGTAGGGGGAGCAGGG + Intronic
1129966617 15:79741955-79741977 TTGGGCACTCACAGGTAGCATGG + Intergenic
1132073656 15:98801255-98801277 AGAGCCGCTCACGGGGAGCAGGG - Intronic
1132114908 15:99128580-99128602 AGGGGCACTCTCGGGGTGGACGG + Intronic
1132607696 16:800403-800425 GGGGGCGTCCACGGGGTGCACGG - Intronic
1133732476 16:8589368-8589390 TGGGGCACTTAGGGTGAGCATGG - Intronic
1134364494 16:13564330-13564352 GGGGGCACACAAAGGGAACAGGG - Intergenic
1136687435 16:32003478-32003500 GGAGGCACTCACTGGGCCCAGGG + Intergenic
1136788049 16:32947029-32947051 GGAGGCACTCACTGGGCCCAGGG + Intergenic
1136881736 16:33906760-33906782 GGAGGCACTCACTGGGCCCAGGG - Intergenic
1137554793 16:49463718-49463740 GGGGGCCCCCTTGGGGAGCATGG - Intergenic
1140440563 16:74984768-74984790 GGGGGCAATCGGGGCGAGCATGG - Intronic
1141592323 16:85077224-85077246 GGGGGCACTCACGGGGAGCAGGG + Intronic
1141822029 16:86453043-86453065 AGAGGCACTCAGGGGGAGTATGG - Intergenic
1142137119 16:88456556-88456578 GGGGGCAGCCAAGGGGAGCAGGG + Intronic
1142141641 16:88475295-88475317 GTGGGCACACACAGGGACCATGG + Intronic
1142307198 16:89292419-89292441 GGGCACATTCACGGGGACCATGG - Intronic
1142342758 16:89534803-89534825 GGGGGCAGTCACGGACAGCGTGG - Intronic
1203090274 16_KI270728v1_random:1208686-1208708 GGAGGCACTCACTGGGCCCAGGG + Intergenic
1143335540 17:6169225-6169247 GGTGGCACTCTCTGGGAGCAGGG + Intergenic
1143609943 17:8012383-8012405 GGGGGCAGGGATGGGGAGCAAGG + Intronic
1144484937 17:15656560-15656582 TGGGGCACATAAGGGGAGCAGGG - Intronic
1144872779 17:18381067-18381089 GGGGGCACTCAGGGAGTGCCAGG - Intronic
1145013830 17:19384400-19384422 GGGAGCACTCATGGAGACCATGG + Exonic
1145979287 17:29002382-29002404 TGGGGCACTAATGGAGAGCAAGG - Intronic
1147148415 17:38499147-38499169 GGAGGCACTCACTGGGCCCAGGG + Intronic
1147311353 17:39597817-39597839 GGGGGCATTCATCGGGGGCACGG - Intergenic
1147556931 17:41485641-41485663 GAGGGCAGTCAGGGAGAGCAGGG - Intergenic
1147879762 17:43646108-43646130 CGGGGCGCGCCCGGGGAGCAGGG + Intronic
1152663217 17:81552503-81552525 GCTGGTACCCACGGGGAGCAGGG + Intronic
1152721108 17:81924204-81924226 GTGGGCACTCACCCGGGGCAGGG - Intronic
1153515334 18:5895920-5895942 AGGGGCGCTCTCGGGGAGCTAGG + Exonic
1156076283 18:33282817-33282839 GGAGGCACTAGCGGGGAGCCGGG - Intronic
1160449862 18:78955197-78955219 GGAGGCACTGACGGAAAGCAAGG + Intergenic
1162311996 19:9913442-9913464 GGGGGCGCTCCCGGGGGGCGTGG - Intronic
1162362972 19:10230769-10230791 GGCGGCACCCACGGGGAGGGCGG - Intronic
1164594719 19:29525693-29525715 CGAGGGACACACGGGGAGCAGGG + Intergenic
1165388473 19:35525333-35525355 GGGGGCACTGCTGGGGTGCATGG - Intronic
1166147668 19:40848604-40848626 CGGGGCACTGGCGGTGAGCAGGG - Exonic
1166178360 19:41090184-41090206 CGGGGCACGCACGGTGAGTAGGG + Exonic
1166367374 19:42284412-42284434 GGGGGCCGTCACGGGGCGCGCGG - Intronic
1166562831 19:43744716-43744738 GTGGGCACCCACTGGGAGCAGGG - Intronic
1168301731 19:55408558-55408580 GGGGTCACACACGGAGTGCAAGG - Intergenic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
929835238 2:45390535-45390557 GGGGGCCTTCAGGAGGAGCATGG - Intronic
930876261 2:56220965-56220987 TGTGGTACTGACGGGGAGCAGGG - Intronic
934773249 2:96921346-96921368 GTGGGCAGTCACGGAGATCAGGG + Intronic
939925774 2:148172313-148172335 GGGAGCAGGCACCGGGAGCAAGG - Intronic
947637302 2:231686532-231686554 GGGGGCACTCAAAGGGCTCAAGG - Intergenic
948826903 2:240577351-240577373 GGGAGCACATACAGGGAGCAGGG - Intronic
1169382481 20:5120063-5120085 GGCGGGCCTCGCGGGGAGCATGG - Intronic
1170603369 20:17858774-17858796 GTGGGCACTCAGGGGAAGTAGGG + Intergenic
1170886287 20:20342725-20342747 TGGGGCACGCACTGGGAACAGGG - Intronic
1175186215 20:57181010-57181032 GGAAGCACCCAAGGGGAGCAAGG - Intronic
1175252308 20:57616900-57616922 GAGGGCACTCCCGGGGAGGATGG - Intronic
1175285498 20:57834244-57834266 AGGAGCCCTCACGGGGAGAAGGG + Intergenic
1178376754 21:32073779-32073801 GGGGGAGCCCACAGGGAGCAGGG + Intergenic
1178752521 21:35318153-35318175 TGGGGAACTCAGGAGGAGCAAGG + Intronic
1179902147 21:44399854-44399876 AGGGGCACTCGCTGGGAGCCAGG - Intronic
1183190101 22:36316673-36316695 CGGGGCACACCCGGGGAGCGTGG + Intronic
1183192915 22:36333094-36333116 TGGGACACACACAGGGAGCATGG + Intronic
1183218395 22:36496129-36496151 GGAGACACTCACAGGGAGGAAGG - Exonic
1183371902 22:37437461-37437483 GGGGGCAGGCACGAGGACCATGG + Intergenic
1184993682 22:48187214-48187236 GTGGGCACTCACTGGAACCATGG + Intergenic
1185208748 22:49554947-49554969 GGGTGCACCCACGGTGATCAGGG + Intronic
950480182 3:13239055-13239077 GGGGAGATTCACAGGGAGCAGGG - Intergenic
951045064 3:18028685-18028707 GGTGACCCTCACTGGGAGCAAGG - Intronic
953850621 3:46463459-46463481 CTGGACACCCACGGGGAGCAGGG + Intronic
954074856 3:48170519-48170541 TGGGGCACCCAAGGAGAGCATGG - Intronic
956029714 3:65024358-65024380 GGGGGCACAACCAGGGAGCAAGG + Intergenic
961333095 3:126154419-126154441 GGGGGCACCCAGTGGGAGTAGGG + Intronic
968547433 4:1206183-1206205 GGGGGCACACATGAGGAGCAGGG - Intronic
968734382 4:2287809-2287831 GGGGGCACTCTGAGGGGGCAGGG + Intronic
968782637 4:2594596-2594618 GGAGGCACTCCCAGGGAGCAGGG - Intronic
968945099 4:3659595-3659617 GGGGGCGTTCAGAGGGAGCAGGG - Intergenic
968971742 4:3799305-3799327 GGAGGCATTCAGGGAGAGCAGGG + Intergenic
976282779 4:83341708-83341730 GGTGGCACTCAGGGAGGGCATGG - Intergenic
978089220 4:104692925-104692947 GGGAGAATTCAAGGGGAGCAAGG - Intergenic
985621861 5:960158-960180 GGGGACACTCACTGGGAGGGGGG - Intergenic
985669720 5:1201156-1201178 GAGGGAACTCAGCGGGAGCAGGG - Intergenic
985758661 5:1733656-1733678 GGGGTCACTCCAGGGGCGCAGGG - Intergenic
985943174 5:3155277-3155299 GTGGCCACCCAGGGGGAGCAGGG - Intergenic
985964825 5:3331984-3332006 GTGGGCACTCAGGGTGTGCATGG - Intergenic
987708692 5:21484017-21484039 GAGGGCCCTCAAGGAGAGCAGGG - Intergenic
988551539 5:32204867-32204889 AGGGGCAGTCCCAGGGAGCAAGG + Intergenic
988750917 5:34190128-34190150 GAGGGCCCTCAAGGAGAGCAGGG + Intergenic
991815513 5:70508168-70508190 GAGGGCCCTCAAGGAGAGCAGGG + Intergenic
995008833 5:107234675-107234697 ACAGGCACTCACAGGGAGCAAGG - Intergenic
995805836 5:116051586-116051608 GGGGGCACTCCCCAGTAGCATGG - Intronic
997518329 5:134506348-134506370 GCTGGCATTCACCGGGAGCAGGG - Intergenic
1003146742 6:3516397-3516419 GGGGGAGATCATGGGGAGCAGGG - Intergenic
1004425585 6:15504853-15504875 GGAGACAGTGACGGGGAGCAGGG - Intronic
1006294508 6:33164168-33164190 CAGGGCACCCAGGGGGAGCAGGG - Intronic
1007679549 6:43624898-43624920 GTTGGCACTGACGAGGAGCAGGG + Exonic
1011304418 6:85910830-85910852 GGTGCAACCCACGGGGAGCAAGG + Intergenic
1012115151 6:95287060-95287082 TGGGGCACTGCCAGGGAGCAGGG + Intergenic
1012725309 6:102803561-102803583 GGGGCCTCTCACGGGGCGGAGGG - Intergenic
1013402116 6:109808097-109808119 AGGAGCACTCACAGGAAGCATGG + Intronic
1016474894 6:144416484-144416506 GGGGGGTCTAGCGGGGAGCAAGG - Intronic
1017033990 6:150250856-150250878 TGAAGCACTCACGGGGATCAGGG - Intergenic
1019320571 7:413734-413756 GGAGACACTCACGGGGGCCAGGG - Intergenic
1019523191 7:1469595-1469617 GGGAGCACTCATGGGGAACCGGG + Intergenic
1019579483 7:1753255-1753277 GGGGGCACACGCGGGGCGTAGGG + Intergenic
1019937617 7:4266794-4266816 GGGGGCACTTACAGGGACCCGGG - Exonic
1022518371 7:30989636-30989658 GGGGGCCCTCACAGGGTGGAGGG + Intronic
1022957275 7:35392651-35392673 GGAGGGACAGACGGGGAGCAGGG + Intergenic
1023025705 7:36047961-36047983 GGGGCCACTCACAGAGAGAAGGG + Intergenic
1023092308 7:36628593-36628615 GGGGGCACTGAAGAGGAGCCAGG + Intronic
1025615333 7:63112874-63112896 GGGGGCCCTCCTGGGGAGCCAGG + Intergenic
1026837697 7:73649401-73649423 GGGGGGACTCAGAGGGAGCATGG - Intergenic
1028155296 7:87422655-87422677 GGGAGGAGTCACAGGGAGCAAGG - Intronic
1029421245 7:100472829-100472851 GGGGCCACTCGCTGGGATCAGGG - Intronic
1029513746 7:101013132-101013154 GGGGACACTCACAGGCAGCGGGG - Exonic
1029658183 7:101941195-101941217 TGGGGAACTCACTGGGAGGAGGG + Intronic
1031078746 7:117238623-117238645 GGGGACACACATGGGGAGCCTGG - Intergenic
1032089194 7:128902826-128902848 GGTGGCTCTCACTGGGAACATGG - Exonic
1033199777 7:139359189-139359211 GGAGGCGATCTCGGGGAGCAGGG - Intronic
1034540623 7:151755809-151755831 GGGGACTCTCACGGGGGCCACGG + Intronic
1034950024 7:155290789-155290811 TAGGGCTCTCACAGGGAGCAGGG - Intergenic
1035946742 8:3971667-3971689 GGGGGTACTCAGAGGGAGAAAGG + Intronic
1037813305 8:22099044-22099066 AGAGGCACACACGGTGAGCAGGG + Exonic
1044464013 8:92482825-92482847 GGGGACACTGAGGGGGAGCAGGG + Intergenic
1046044025 8:108942548-108942570 GGGGGCACTGCAGGGGACCAGGG - Intergenic
1048423040 8:134295911-134295933 CTGGGCACTCACGGGAGGCAGGG - Intergenic
1049279201 8:141735726-141735748 GGGGGCGGTCAGGAGGAGCATGG - Intergenic
1052785756 9:32826686-32826708 GTGGGGAGTCACGGGGAGAAGGG + Intergenic
1053682676 9:40496032-40496054 GGGGGAACTCAGGGGAGGCATGG + Intergenic
1053932658 9:43124373-43124395 GGGGGAACTCAGGGGAGGCATGG + Intergenic
1054281038 9:63128897-63128919 GGGGGAACTCAGGGGAGGCATGG - Intergenic
1054295775 9:63331546-63331568 GGGGGAACTCAGGGGAGGCATGG + Intergenic
1054393794 9:64636041-64636063 GGGGGAACTCAGGGGAGGCATGG + Intergenic
1054428442 9:65141254-65141276 GGGGGAACTCAGGGGAGGCATGG + Intergenic
1054501938 9:65880291-65880313 GGGGGAACTCAGGGGAGGCATGG - Intronic
1056126155 9:83538037-83538059 CGGGGCACACGCCGGGAGCAGGG - Intronic
1057412579 9:94830193-94830215 GGAGTCTGTCACGGGGAGCAGGG - Intronic
1059434751 9:114269256-114269278 CTGGGCACTCCTGGGGAGCAGGG + Exonic
1059705087 9:116815433-116815455 GGGGGCACTCACGGCCAGTTAGG - Intronic
1059922891 9:119177930-119177952 GGTGGTGTTCACGGGGAGCAGGG + Intronic
1062389456 9:136328091-136328113 CGGGGCACTCAGGGGCATCATGG + Intronic
1062545970 9:137063901-137063923 GGGGGCCCTCCTGGGGAGCCAGG + Exonic
1062564339 9:137157225-137157247 GGGGGCACTCTCGGGGAGGTGGG + Intronic
1203416716 Un_KI270330v1:246-268 TGGGGCCCTCACGGGAACCATGG - Intergenic
1203550762 Un_KI270743v1:163852-163874 TGGGGCCCTCACGGGAACCATGG - Intergenic
1185465849 X:353930-353952 GGGGGCTCACCCAGGGAGCAGGG + Intronic
1186770357 X:12811997-12812019 GTGGGCAGTCACGGGGTGGAGGG + Intronic
1190650274 X:52562839-52562861 GGGGTCCCTCACGGTGAGCCTGG + Intergenic
1197720559 X:129742171-129742193 GGGGGCACTCACAGGGGGGTTGG - Exonic
1200279275 X:154762939-154762961 GGCGGCACGCACGCGGTGCAGGG + Exonic