ID: 1141593344

View in Genome Browser
Species Human (GRCh38)
Location 16:85082896-85082918
Sequence GGCGGTGACGCCGGGGAAAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141593335_1141593344 18 Left 1141593335 16:85082855-85082877 CCTTGAGACGCCCTGGCGACAGC 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1141593344 16:85082896-85082918 GGCGGTGACGCCGGGGAAAGCGG 0: 1
1: 0
2: 1
3: 11
4: 173
1141593337_1141593344 7 Left 1141593337 16:85082866-85082888 CCTGGCGACAGCATGAGCTCGAG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1141593344 16:85082896-85082918 GGCGGTGACGCCGGGGAAAGCGG 0: 1
1: 0
2: 1
3: 11
4: 173
1141593336_1141593344 8 Left 1141593336 16:85082865-85082887 CCCTGGCGACAGCATGAGCTCGA 0: 1
1: 0
2: 0
3: 6
4: 62
Right 1141593344 16:85082896-85082918 GGCGGTGACGCCGGGGAAAGCGG 0: 1
1: 0
2: 1
3: 11
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141593344 Original CRISPR GGCGGTGACGCCGGGGAAAG CGG Intronic