ID: 1141595763

View in Genome Browser
Species Human (GRCh38)
Location 16:85095921-85095943
Sequence GACCAATGGTCCCGGAGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141595763_1141595772 3 Left 1141595763 16:85095921-85095943 CCTGTACTCCGGGACCATTGGTC No data
Right 1141595772 16:85095947-85095969 TTGGTGCACTGGGGCCAAAGGGG No data
1141595763_1141595767 -8 Left 1141595763 16:85095921-85095943 CCTGTACTCCGGGACCATTGGTC No data
Right 1141595767 16:85095936-85095958 CATTGGTCTCTTTGGTGCACTGG No data
1141595763_1141595770 1 Left 1141595763 16:85095921-85095943 CCTGTACTCCGGGACCATTGGTC No data
Right 1141595770 16:85095945-85095967 CTTTGGTGCACTGGGGCCAAAGG No data
1141595763_1141595773 7 Left 1141595763 16:85095921-85095943 CCTGTACTCCGGGACCATTGGTC No data
Right 1141595773 16:85095951-85095973 TGCACTGGGGCCAAAGGGGAAGG No data
1141595763_1141595775 9 Left 1141595763 16:85095921-85095943 CCTGTACTCCGGGACCATTGGTC No data
Right 1141595775 16:85095953-85095975 CACTGGGGCCAAAGGGGAAGGGG No data
1141595763_1141595771 2 Left 1141595763 16:85095921-85095943 CCTGTACTCCGGGACCATTGGTC No data
Right 1141595771 16:85095946-85095968 TTTGGTGCACTGGGGCCAAAGGG No data
1141595763_1141595769 -6 Left 1141595763 16:85095921-85095943 CCTGTACTCCGGGACCATTGGTC No data
Right 1141595769 16:85095938-85095960 TTGGTCTCTTTGGTGCACTGGGG No data
1141595763_1141595774 8 Left 1141595763 16:85095921-85095943 CCTGTACTCCGGGACCATTGGTC No data
Right 1141595774 16:85095952-85095974 GCACTGGGGCCAAAGGGGAAGGG No data
1141595763_1141595768 -7 Left 1141595763 16:85095921-85095943 CCTGTACTCCGGGACCATTGGTC No data
Right 1141595768 16:85095937-85095959 ATTGGTCTCTTTGGTGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141595763 Original CRISPR GACCAATGGTCCCGGAGTAC AGG (reversed) Intergenic
No off target data available for this crispr