ID: 1141597658

View in Genome Browser
Species Human (GRCh38)
Location 16:85107237-85107259
Sequence CCGGGAGGTAGAGTGAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 327}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141597658_1141597674 28 Left 1141597658 16:85107237-85107259 CCAGCTCTCACTCTACCTCCCGG 0: 1
1: 0
2: 2
3: 24
4: 327
Right 1141597674 16:85107288-85107310 AGTAAGACAGACAGCATGCGGGG 0: 1
1: 0
2: 1
3: 16
4: 174
1141597658_1141597663 -3 Left 1141597658 16:85107237-85107259 CCAGCTCTCACTCTACCTCCCGG 0: 1
1: 0
2: 2
3: 24
4: 327
Right 1141597663 16:85107257-85107279 CGGCCCCTGCATCTTTCCCACGG 0: 1
1: 0
2: 0
3: 19
4: 153
1141597658_1141597673 27 Left 1141597658 16:85107237-85107259 CCAGCTCTCACTCTACCTCCCGG 0: 1
1: 0
2: 2
3: 24
4: 327
Right 1141597673 16:85107287-85107309 CAGTAAGACAGACAGCATGCGGG 0: 1
1: 0
2: 2
3: 18
4: 202
1141597658_1141597669 3 Left 1141597658 16:85107237-85107259 CCAGCTCTCACTCTACCTCCCGG 0: 1
1: 0
2: 2
3: 24
4: 327
Right 1141597669 16:85107263-85107285 CTGCATCTTTCCCACGGGGCAGG No data
1141597658_1141597665 -1 Left 1141597658 16:85107237-85107259 CCAGCTCTCACTCTACCTCCCGG 0: 1
1: 0
2: 2
3: 24
4: 327
Right 1141597665 16:85107259-85107281 GCCCCTGCATCTTTCCCACGGGG 0: 1
1: 0
2: 1
3: 8
4: 143
1141597658_1141597664 -2 Left 1141597658 16:85107237-85107259 CCAGCTCTCACTCTACCTCCCGG 0: 1
1: 0
2: 2
3: 24
4: 327
Right 1141597664 16:85107258-85107280 GGCCCCTGCATCTTTCCCACGGG 0: 1
1: 0
2: 3
3: 19
4: 193
1141597658_1141597672 26 Left 1141597658 16:85107237-85107259 CCAGCTCTCACTCTACCTCCCGG 0: 1
1: 0
2: 2
3: 24
4: 327
Right 1141597672 16:85107286-85107308 ACAGTAAGACAGACAGCATGCGG 0: 1
1: 0
2: 2
3: 32
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141597658 Original CRISPR CCGGGAGGTAGAGTGAGAGC TGG (reversed) Intronic