ID: 1141598302

View in Genome Browser
Species Human (GRCh38)
Location 16:85110663-85110685
Sequence GTGGGCAGGAATATAAATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141598293_1141598302 19 Left 1141598293 16:85110621-85110643 CCATTGAGGCTGATGAGGGGGAT 0: 1
1: 0
2: 0
3: 11
4: 131
Right 1141598302 16:85110663-85110685 GTGGGCAGGAATATAAATGCGGG 0: 1
1: 0
2: 0
3: 12
4: 156
1141598299_1141598302 -7 Left 1141598299 16:85110647-85110669 CCTGGGCTGGTCAGTAGTGGGCA 0: 1
1: 0
2: 3
3: 27
4: 254
Right 1141598302 16:85110663-85110685 GTGGGCAGGAATATAAATGCGGG 0: 1
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141598302 Original CRISPR GTGGGCAGGAATATAAATGC GGG Intronic
900198570 1:1390775-1390797 CCGGGCAGCAAGATAAATGCAGG + Exonic
902055849 1:13599817-13599839 TGTGGAAGGAATATAAATGCTGG + Intronic
906733765 1:48105053-48105075 GTGGCCAAGAATATAAGTGCTGG - Intergenic
909586699 1:77298295-77298317 GTTGGCATGAATATAAGTACAGG - Intronic
909702259 1:78539436-78539458 TTGGGTCAGAATATAAATGCTGG + Exonic
909722837 1:78796434-78796456 GTGGGCAGAAAAATAAATACTGG - Intergenic
909977355 1:82060605-82060627 GTAGGCAGGAAAATAAAAGGCGG - Intergenic
910852408 1:91661725-91661747 ATGGGCAGGAAAATAATTCCAGG + Intergenic
915254885 1:154619909-154619931 GTACCCAGGAGTATAAATGCTGG - Intronic
915352050 1:155232979-155233001 GTGGGCAGGAAGAAACAGGCAGG - Intergenic
916104365 1:161420110-161420132 GTGGGAAGGAAGAAAAATGAAGG + Intergenic
917926301 1:179791713-179791735 GAGGGCAAAAATATAAATGGAGG - Intronic
919085360 1:192914594-192914616 GTGGTCAGGAAAAAGAATGCTGG + Intergenic
923873968 1:238027729-238027751 GTGGTAAAGAATATAAATGTGGG + Intergenic
924447156 1:244144035-244144057 GTGGGAAGGAAAAGAAAGGCAGG + Intergenic
1065445998 10:25800283-25800305 TTGGGCAAGAGTACAAATGCAGG - Intergenic
1068275622 10:54792121-54792143 ATGGACTGGAATATAGATGCAGG + Intronic
1070355760 10:75638580-75638602 GTGTGCAGCAAAATATATGCTGG - Intronic
1070368915 10:75763285-75763307 ATGGCCAGAAATATAAATGTAGG + Intronic
1071513843 10:86284053-86284075 GAGGGCAGGTATGTATATGCAGG - Intronic
1072264221 10:93712251-93712273 CTGGGCAGGAATATCAGTGCTGG + Intergenic
1073085921 10:100888711-100888733 GTGGGCTGGCATCTAAATGGTGG - Intergenic
1078831296 11:14979814-14979836 TTGGCCAGGAATGTAAATGATGG + Intronic
1079645704 11:22861653-22861675 GTGAGCTGGAATTTAAATCCAGG + Intergenic
1079678872 11:23267059-23267081 GTGAGCAGCAATGTAAAAGCAGG - Intergenic
1081626234 11:44656945-44656967 GTGGGCCGGAATAGAACTGCTGG + Intergenic
1081740493 11:45436169-45436191 GAGGGCAGGCATGTAAAGGCTGG + Intergenic
1084127723 11:67111593-67111615 GAGGGAAGGAATATGAAGGCTGG - Intergenic
1086896260 11:92316344-92316366 GTTGGCAGGAGTATAACTGTTGG + Intergenic
1092085098 12:5750555-5750577 GTGGGCAGGCAGATAATTCCTGG - Intronic
1093043789 12:14417871-14417893 CTGGGCAGGAATCAGAATGCTGG + Intronic
1094204498 12:27826121-27826143 TTGGGCAGGAATATCAATAGTGG - Intergenic
1094252848 12:28386004-28386026 GTGTGAAGGACTATAAATTCTGG - Intronic
1095285828 12:40409247-40409269 ATGGTCAAGAGTATAAATGCAGG + Intronic
1095673567 12:44890219-44890241 GTGAGCAAGAAAATAAATGTGGG + Intronic
1096103862 12:48985580-48985602 GTGAGCAGGAATATCCATGCAGG + Intergenic
1096529123 12:52232527-52232549 ATGGGCAGGAATATGAGTGGAGG + Intronic
1096778375 12:53977691-53977713 GTGGGCAGGAATGCAACTGAGGG + Intergenic
1097095072 12:56540681-56540703 GTGGGGATTAAAATAAATGCAGG - Intronic
1098717261 12:73846063-73846085 TTGGGCAAGAATACAAATGAAGG + Intergenic
1101431239 12:104629132-104629154 CAGGGCTGGAATACAAATGCAGG - Intronic
1101641929 12:106592457-106592479 GTGGGCTTGAATTTAAATCCTGG + Intronic
1102703834 12:114864096-114864118 GTGGCCAGGAATCGAAAGGCTGG + Intergenic
1104588240 12:130064284-130064306 CTGGGCAGGAAGCTCAATGCAGG + Intergenic
1109282672 13:60375114-60375136 CTGGGCAAGAATAAAAAAGCTGG + Intergenic
1110585750 13:77189877-77189899 ATGGGGAGGACTATAGATGCAGG - Intronic
1111460696 13:88537828-88537850 GTAGGCATGAAAATACATGCAGG + Intergenic
1121055113 14:90845763-90845785 GGGGGCAGGAGGAGAAATGCTGG + Intergenic
1124820553 15:33041752-33041774 ATTGGCAGAAATATAAATGAGGG + Intronic
1125736946 15:41933598-41933620 GAGGGAAAGATTATAAATGCAGG - Intronic
1126869916 15:52976773-52976795 GGGGGACAGAATATAAATGCAGG - Intergenic
1127605247 15:60580622-60580644 ATGACCAGGAATATAAAAGCAGG - Intronic
1130193370 15:81757077-81757099 CTGGGCAGGGATATTAAGGCAGG - Intergenic
1130217720 15:81987887-81987909 GTTGGCAGGAATATAAAGCAAGG - Intergenic
1130367513 15:83253717-83253739 CATGGCAGGAATATAATTGCAGG + Intergenic
1134408351 16:13982315-13982337 TTGGGCAAGAATATAAAGGGGGG - Intergenic
1135177903 16:20247375-20247397 GTTGACAGGAATATAAATACGGG - Intergenic
1140333462 16:74080889-74080911 TTGGGCAGAAGTAGAAATGCTGG - Intergenic
1141445876 16:84057992-84058014 CATGGCTGGAATATAAATGCTGG + Intronic
1141598302 16:85110663-85110685 GTGGGCAGGAATATAAATGCGGG + Intronic
1144297659 17:13892859-13892881 GTGTTCAGGCATATAAGTGCTGG - Intergenic
1145829653 17:27905718-27905740 GTGGGCAGACAGATGAATGCTGG - Intergenic
1145861907 17:28218036-28218058 GTGGCCTGGAATATGAATGTGGG + Intergenic
1145972299 17:28963519-28963541 GTGGGCAGGGACATAGAGGCAGG - Intronic
1146851636 17:36226944-36226966 GTGGGAAGGAAAAGAAATGAGGG + Intronic
1146867545 17:36350820-36350842 GTGGGAAGGAAAAGAAATGAGGG + Intronic
1147070421 17:37951434-37951456 GTGGGAAGGAAAAGAAATGAGGG + Intergenic
1147081945 17:38030959-38030981 GTGGGAAGGAAAAGAAATGAGGG + Intronic
1147097894 17:38154924-38154946 GTGGGAAGGAAAAGAAATGAGGG + Intergenic
1148265371 17:46221911-46221933 GTGGGCTGGAAAATAAAAGTGGG - Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148705600 17:49628250-49628272 GTAAGCAGGAAAATAAATGGTGG - Intronic
1149666620 17:58369379-58369401 GTGGGCAGGATTCTGAATGTGGG - Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151981765 17:77515659-77515681 GTGGTTAGAAATAAAAATGCTGG + Intergenic
1153393440 18:4590513-4590535 CTGGGCAGGAATAAAAATATTGG + Intergenic
1155852533 18:30790654-30790676 ATGGGCAGGAATATAAGTCATGG + Intergenic
1157970672 18:52264414-52264436 GTGGGGAGGAAAATAGATGTTGG - Intergenic
1158523467 18:58191650-58191672 GGTGGCAGGAGTATATATGCTGG - Intronic
1158881083 18:61780324-61780346 TTGGGGAGGAATAAAAAGGCAGG - Intergenic
1159778217 18:72628521-72628543 GTGGGAAGGAGTATAAAGGCCGG - Intronic
1160312101 18:77803919-77803941 GTGCTCAGGAATATAATTGTTGG + Intergenic
1162162523 19:8729275-8729297 GTACGCAGGAATATAAATAGGGG - Intergenic
1162204421 19:9045099-9045121 GTGGGTACGAATATAACTGAGGG - Intergenic
1164586267 19:29478077-29478099 GTGGGCAGGCCCACAAATGCGGG + Intergenic
1166561354 19:43734339-43734361 GTGGGCAGGAGGAAAAATGAGGG - Intronic
1168481645 19:56724957-56724979 ATGGACAGGAATCTAACTGCAGG - Intergenic
925947658 2:8880548-8880570 TTGGGCGGGAATATAAATTAAGG + Intronic
926560991 2:14417181-14417203 GAGAGCAGGATTATAAATCCTGG - Intergenic
927418662 2:22906507-22906529 GTGAGCATAAGTATAAATGCTGG - Intergenic
927710740 2:25324367-25324389 CAGGGCAGGATTATAAATCCAGG + Intronic
934786853 2:97016130-97016152 GTAGTCAGGAATATAGAAGCTGG - Intronic
937126825 2:119480337-119480359 GTGGGCAGGAGGACACATGCAGG + Intronic
940945588 2:159615020-159615042 GAGGGCAGGAAAAAAAATGGAGG + Intronic
944187594 2:196966710-196966732 GTGGGAGGGAAAATAAATCCTGG - Intergenic
944860487 2:203811490-203811512 GTGCGTAGGAATAGAATTGCTGG + Intergenic
946951694 2:224883032-224883054 ATGAAGAGGAATATAAATGCAGG + Intronic
948510176 2:238458745-238458767 GTGGGCAGGAAATTACTTGCTGG + Intergenic
1177560491 21:22744527-22744549 GTGGGAAGGAGAATGAATGCAGG + Intergenic
1178293814 21:31391743-31391765 GCGGGCAAGAATACAAATGGAGG - Intronic
1180335116 22:11570833-11570855 GTAGCTAGGAATATTAATGCTGG - Intergenic
1183671934 22:39278155-39278177 GTGCGCAGGAATCTACATCCTGG + Intergenic
1185033361 22:48457617-48457639 GGTGGAAGGAATATAAATTCAGG + Intergenic
949813903 3:8038414-8038436 TTGAGCAGGAATAAAAATCCAGG + Intergenic
950645064 3:14372114-14372136 GTGGGCAGTGATATAAACGCAGG - Intergenic
953509794 3:43524439-43524461 GTGGGGTGGACTGTAAATGCAGG - Intronic
955746005 3:62141155-62141177 GTTGGCAAGGATATGAATGCAGG + Intronic
957276916 3:78102183-78102205 GTTGCCAGGAAAATAAATACAGG + Intergenic
958673279 3:97232431-97232453 GTTTGCAGGAATACAAATGATGG - Intronic
960385008 3:117012305-117012327 TGGGGCAGGAATATAAAGGGAGG + Intronic
962316180 3:134360864-134360886 TTGGGGAGGCATATAAAAGCTGG + Intronic
963983293 3:151564023-151564045 GTGTTTAGGAACATAAATGCTGG - Intergenic
973633694 4:52842791-52842813 GTGGGCAGGAAAATGAAGCCAGG + Intergenic
974429164 4:61773915-61773937 GTGGGAAGGTAAATATATGCGGG + Intronic
975241440 4:72064578-72064600 GTGGGAAGGAATATAAAGCAAGG + Intronic
977016243 4:91695928-91695950 GTAGGAAGGAGAATAAATGCAGG + Intergenic
983588079 4:169376744-169376766 ATGTGCACGAAAATAAATGCAGG + Intergenic
984543234 4:181067457-181067479 CTGGGAAGGTATTTAAATGCCGG + Intergenic
986186114 5:5440855-5440877 CTGGGCTGGAATATAATGGCTGG - Intronic
987752238 5:22055406-22055428 GTTGTCAGGAATGAAAATGCAGG - Intronic
988778251 5:34496452-34496474 GTGGGCAGAAATAGGAAGGCAGG + Intergenic
989117241 5:37966827-37966849 GATGGCAGGAATATATTTGCTGG + Intergenic
990729873 5:58796582-58796604 GTTGGCAGGAATATAAAAATGGG + Intronic
995237043 5:109840871-109840893 GTGGGAAAGAGTGTAAATGCAGG - Intronic
997617970 5:135265610-135265632 CTCGGCAGGAAGATAAAGGCTGG + Intronic
998616241 5:143743750-143743772 GTGGCCATGAATAAACATGCTGG + Intergenic
999585745 5:153087861-153087883 GTAGGCAGGAGAATAGATGCTGG - Intergenic
1002907798 6:1464927-1464949 GTGGGCTGGAATATAAGGGTTGG - Intergenic
1003128517 6:3375540-3375562 GTGGGCAGGGATATGAGTTCTGG + Intronic
1004767969 6:18752862-18752884 GAGAGCAGCAAAATAAATGCGGG - Intergenic
1005877240 6:30020470-30020492 GTGAGCAGGAATACAACTGCTGG + Intergenic
1011290876 6:85775972-85775994 GTAGGAAGGAAAATGAATGCAGG + Intergenic
1015481195 6:133711812-133711834 ATGGGCAGGAATATAATGGCAGG - Intergenic
1016869081 6:148798819-148798841 GTGGTCAGGAAAAGCAATGCAGG + Intronic
1018598931 6:165517727-165517749 GAGGGCAGGATTATAAAGGACGG + Intronic
1019882563 7:3875682-3875704 GTGGGCAGGGATCTAAAGGAAGG + Intronic
1020489225 7:8758784-8758806 GGAGGCAAGATTATAAATGCTGG + Intergenic
1022477402 7:30720474-30720496 GTGAGCAGGACTTTAAAGGCAGG - Intronic
1022984232 7:35635025-35635047 GAGTGAAGGAATATGAATGCTGG - Intronic
1026897987 7:74021621-74021643 GTGGGCAGGAGGACAAAGGCTGG + Intergenic
1028629632 7:92920652-92920674 CTGGGCAGGAAGAACAATGCTGG - Intergenic
1028742654 7:94293580-94293602 GTGTGCAGGAATACAGCTGCAGG + Intergenic
1029250435 7:99232606-99232628 GTGGGCAGAAATAGAACAGCTGG - Intergenic
1030567537 7:111177870-111177892 GAGGGCAGGAAGTTAAATCCTGG + Intronic
1031054671 7:116980252-116980274 GTGATCAGGAATATGAATGCTGG - Intronic
1033500905 7:141948337-141948359 GTTATCAGAAATATAAATGCTGG + Intronic
1033669343 7:143476168-143476190 GTTGACAGGAATATAAATTATGG + Intergenic
1037755727 8:21709041-21709063 GTGGGCAAGAAGATAAAGGCAGG + Intronic
1039002728 8:32999300-32999322 TTGAGCAACAATATAAATGCTGG - Intergenic
1044537315 8:93372084-93372106 GGGGGCTGAAATATAAATGTTGG - Intergenic
1045501204 8:102745616-102745638 GTGAGCAGGAATGTTACTGCAGG + Intergenic
1046102699 8:109632902-109632924 GAGGGCAGGAATAGCCATGCCGG + Intronic
1047433760 8:124817093-124817115 ATGGGCTGGAATATAAAACCAGG + Intergenic
1048380510 8:133861201-133861223 ATTGGCAGGAATAGAAAAGCAGG + Intergenic
1049293608 8:141817676-141817698 GTGGGCAGGAATGGACAGGCTGG + Intergenic
1050861826 9:10444010-10444032 CTTGGCAGGAATATGAATGTTGG - Intronic
1053228523 9:36384349-36384371 GAGGGTAGGAATATAAATTTAGG + Intronic
1055394247 9:75856871-75856893 GTGGTCAGAAATATAATTGGAGG - Intergenic
1055761912 9:79618055-79618077 GTGGGCAGGTAACTAAGTGCTGG - Intronic
1056000011 9:82205226-82205248 AGGGACAGGAATATATATGCTGG - Intergenic
1056913926 9:90729144-90729166 CTGGGCAAGAGTACAAATGCTGG + Intergenic
1059757715 9:117309526-117309548 GAAGGCAGGAAGATAGATGCAGG + Intronic
1059757821 9:117310323-117310345 GAAGGCAGGAAGATAGATGCAGG - Intronic
1189396711 X:40629403-40629425 CTGGGCTGGGATATAAATGTTGG - Exonic
1192320821 X:70089230-70089252 TGTGGCAGGAATATACATGCAGG - Intergenic
1196032530 X:111106653-111106675 GTGAGAAAGTATATAAATGCAGG - Intronic
1196646615 X:118124673-118124695 CTGGTCAGTAATATAACTGCTGG - Intergenic
1201142837 Y:11042724-11042746 GTGGGCAGAAATATACCTCCAGG + Intergenic