ID: 1141602244

View in Genome Browser
Species Human (GRCh38)
Location 16:85133893-85133915
Sequence TTAGGTTCCCAGTGGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141602244_1141602250 8 Left 1141602244 16:85133893-85133915 CCTTTCACCCACTGGGAACCTAA No data
Right 1141602250 16:85133924-85133946 GTCCCTCCAGGCTCAGCCTAAGG No data
1141602244_1141602248 -4 Left 1141602244 16:85133893-85133915 CCTTTCACCCACTGGGAACCTAA No data
Right 1141602248 16:85133912-85133934 CTAAACTCACCTGTCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141602244 Original CRISPR TTAGGTTCCCAGTGGGTGAA AGG (reversed) Intergenic
No off target data available for this crispr