ID: 1141604407

View in Genome Browser
Species Human (GRCh38)
Location 16:85144745-85144767
Sequence GCTCTCACTGGGCCAAAATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 9, 3: 52, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141604401_1141604407 25 Left 1141604401 16:85144697-85144719 CCTCGCAGCTGCTTCTCTCCTGC 0: 1
1: 0
2: 3
3: 38
4: 342
Right 1141604407 16:85144745-85144767 GCTCTCACTGGGCCAAAATCCGG 0: 1
1: 0
2: 9
3: 52
4: 146
1141604403_1141604407 7 Left 1141604403 16:85144715-85144737 CCTGCTTCTGCAGGTCAGAAGTC 0: 1
1: 1
2: 12
3: 46
4: 307
Right 1141604407 16:85144745-85144767 GCTCTCACTGGGCCAAAATCCGG 0: 1
1: 0
2: 9
3: 52
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141604407 Original CRISPR GCTCTCACTGGGCCAAAATC CGG Intergenic
900934409 1:5756124-5756146 AGTCTCACTGGGCTAAAATCAGG + Intergenic
902226637 1:15000320-15000342 GGTTTCACTGGGCCAAAATCAGG - Intronic
903303396 1:22394704-22394726 GATCTCACTGGGCTAAAACAAGG - Intergenic
903469395 1:23575268-23575290 GATCTCACTGGGCTAAAATCAGG - Intergenic
905450295 1:38051765-38051787 GCTGACACTGGCCCAAAATGAGG - Intergenic
908996567 1:70163013-70163035 GGTCTCATTGGGCTAAAATCAGG + Intronic
911622297 1:100079001-100079023 GGTTGCACTGAGCCAAAATCAGG + Intronic
912228751 1:107767544-107767566 GTCCTCATTCGGCCAAAATCAGG + Intronic
915505225 1:156351220-156351242 GGTATCACTGGGCTAAAATCAGG + Intronic
919119460 1:193321087-193321109 GGTCTTACTGGGCTAGAATCAGG - Intergenic
920794398 1:209124577-209124599 GTTCTCACAGGGCTAAAATCAGG - Intergenic
922520955 1:226251770-226251792 GCTTTCACTGGTCCAAAATAGGG + Intronic
923042359 1:230328167-230328189 GCTCTTATTGGGCTGAAATCAGG - Intronic
923271076 1:232355468-232355490 GCTCTCATTGGGCCAGGGTCAGG + Intergenic
924738605 1:246781185-246781207 GGTCTCATTGGGCTAAAAGCAGG - Intergenic
1063131351 10:3180447-3180469 GATCTCACTGTGCTAAAATCAGG + Intergenic
1064317173 10:14269386-14269408 GGTCTCAAGGGGCTAAAATCAGG + Intronic
1064860304 10:19817880-19817902 GCCCTCTCGGGGACAAAATCAGG - Intronic
1066560914 10:36668887-36668909 GGTTTCAGTGGGCCAAGATCAGG - Intergenic
1068054407 10:51993593-51993615 GCTCTCACTGGGTCATACTGAGG + Intronic
1068680214 10:59811100-59811122 GGACTCACTAGGCTAAAATCAGG - Intronic
1069861504 10:71474450-71474472 GCTCTCACTGGTCAAACATTTGG + Intronic
1070576843 10:77685926-77685948 GCTCTCAATGGGGCAAGACCCGG + Intergenic
1071526039 10:86359034-86359056 GGTCTCACTGGGCTAAAATCTGG - Intronic
1072429952 10:95362032-95362054 GCTCTTCCTGAACCAAAATCTGG - Intronic
1072489151 10:95886752-95886774 GGTCTCAGTGGGCTAAAATCAGG - Intronic
1073814706 10:107193791-107193813 GGTCTCACTGGACGAAAATCAGG - Intergenic
1075489767 10:122856675-122856697 TCTTTCCCTGGGCCTAAATCAGG + Intronic
1076616693 10:131759760-131759782 GACCTCACTGGACTAAAATCAGG + Intergenic
1080419577 11:32097951-32097973 GCACTCACGCGGCCAGAATCGGG + Intronic
1080973041 11:37301990-37302012 ACTACCACTGGGCCAAAGTCAGG + Intergenic
1081560177 11:44206793-44206815 ATTCTCTCTGGCCCAAAATCCGG + Exonic
1083411932 11:62499842-62499864 GCTCCATCTGGGCCAAAATGGGG + Intronic
1084190752 11:67497639-67497661 TCCCGCACTGGGCCAAACTCCGG + Exonic
1090671799 11:128952749-128952771 AGTCTCACTGGGCTAAAATCAGG + Intergenic
1091027743 11:132157075-132157097 ACTCTCACTAGGCTGAAATCAGG - Intronic
1091149435 11:133313760-133313782 GGTCTCCATGGGCTAAAATCAGG - Intronic
1091179347 11:133589348-133589370 GCTCACACTGAGCCAAAGGCTGG + Intergenic
1092928915 12:13296923-13296945 GGTCTCACCAGGCTAAAATCAGG + Intergenic
1094159689 12:27377437-27377459 GCTCTCTCTGAGCCAGGATCTGG - Intronic
1094574623 12:31673950-31673972 GGTCTCACTGGGCTAAAATCAGG + Intronic
1094718639 12:33038617-33038639 CATCTCACTGAGCCTAAATCAGG + Intergenic
1098063862 12:66591400-66591422 GCTCCCAGTGGGCCAAAGTGAGG - Intronic
1100046766 12:90391960-90391982 AGTTTCACTGGGCCGAAATCAGG + Intergenic
1101918275 12:108912646-108912668 GGTCTCAATGGGCAAAAAGCAGG + Exonic
1104043242 12:125144154-125144176 GGTCTCACTGGGCTGAAATCAGG + Intergenic
1107774148 13:43820480-43820502 GCTCTCACTGGTCAAAGATAGGG + Intergenic
1110502599 13:76246125-76246147 GTACTCACTGGGGCAAAACCTGG + Intergenic
1110523121 13:76504419-76504441 GGTCTCACAAGGCTAAAATCAGG + Intergenic
1111839571 13:93433276-93433298 GCCCTCACTGGGCCACCAGCAGG - Intronic
1112703333 13:102037280-102037302 GGTCTCAGTGGACTAAAATCAGG + Intronic
1114662480 14:24356281-24356303 GGCCTCACTGGGCTAAAATCAGG + Intergenic
1115164227 14:30429906-30429928 GCTCTCCCTGGTCAAAAAGCTGG + Intergenic
1116315735 14:43389544-43389566 GTTCTCATTGGGCCAAACTAAGG - Intergenic
1117743310 14:58841679-58841701 TCTGTAACTGTGCCAAAATCTGG - Intergenic
1118255802 14:64204848-64204870 GATCTCACTGGGCTAAGATCAGG + Intronic
1121388619 14:93554605-93554627 GCTAACACAGGGCCAGAATCTGG - Intronic
1123035981 14:105472133-105472155 GCCCTCACAGGGCCAAGCTCTGG + Intergenic
1126449465 15:48789843-48789865 GATCTCACTAGGCTAAAATCAGG - Intronic
1127087462 15:55437837-55437859 AGTTTCACTGGGCCAAAATTAGG - Intronic
1132848439 16:2012067-2012089 GGTCACACTGAGCTAAAATCAGG + Intronic
1133790670 16:9007209-9007231 GGTCTCACTGGGCTGAAATCAGG - Intergenic
1137826890 16:51505507-51505529 GCTTGCAGTGGGCCAAGATCAGG + Intergenic
1138391941 16:56676502-56676524 GCTTTCAGTGAGCCAAGATCGGG - Intronic
1138985438 16:62322502-62322524 GGTCTCACTGGGCTAAAATCGGG + Intergenic
1141604407 16:85144745-85144767 GCTCTCACTGGGCCAAAATCCGG + Intergenic
1141804187 16:86331907-86331929 GGCCTCACTGGGCTAAAATTAGG + Intergenic
1142335040 16:89482951-89482973 GATCTGCCTGGGCTAAAATCTGG - Intronic
1143061741 17:4207528-4207550 GGAATCACTGGCCCAAAATCAGG - Intronic
1143607194 17:7994305-7994327 AGTTTCACTGGGCCCAAATCCGG + Intergenic
1147035712 17:37678833-37678855 AGTATCACTGGACCAAAATCAGG - Intergenic
1147323509 17:39659508-39659530 TCTCTTCCTGGGCCAAGATCTGG - Exonic
1149792364 17:59490587-59490609 GCTCTCACTTGACAAAAATCCGG - Intergenic
1150756356 17:67917872-67917894 GCTTTCAGTGAGCCAAGATCCGG - Intronic
1151436945 17:74103573-74103595 ACTCTCTCTGGGCCAAAAACCGG + Intergenic
1152395376 17:80029829-80029851 GGTCTCACAGGGCTAAAACCAGG + Intronic
1153711396 18:7803221-7803243 CATCTCACTGGGCTAAACTCAGG + Intronic
1156314172 18:35951850-35951872 GGGCTCATTGGGCCAAAATCAGG + Intergenic
1156509719 18:37626256-37626278 GGTCTCGCTGGGCTACAATCGGG + Intergenic
1158511091 18:58091260-58091282 TCCCTCACTGTGCCAAATTCTGG - Intronic
1159001830 18:62981602-62981624 TCTCTCACTGGGCCGAGATGAGG - Intergenic
1159046843 18:63376753-63376775 GGTCTCACTGGGCTAAAATCAGG - Intergenic
1159433760 18:68388559-68388581 GCTCTAACTGGACTTAAATCAGG + Intergenic
1159659025 18:71070543-71070565 GCTCTCAGCGGTCTAAAATCAGG - Intergenic
1161726821 19:5934065-5934087 GCTCCCCCTGGGCCAGAGTCCGG + Intronic
1162001275 19:7746571-7746593 GCTCTCCCTGGGCCAGGCTCCGG - Intronic
1162003902 19:7765123-7765145 GCTCTCCCTGGGCCAGGCTCAGG + Intronic
1162727136 19:12696451-12696473 GTTCTCAGTCCGCCAAAATCCGG - Exonic
1162931546 19:13960154-13960176 GCTCTCCCTGTGCCACAACCTGG + Intronic
1164415808 19:28045732-28045754 GTCCTCATTGGGCCAAACTCAGG - Intergenic
1164416138 19:28047932-28047954 GTCCTCATTGGGCCAAACTCAGG - Intergenic
1166599635 19:44082596-44082618 CATCTCACTGGACAAAAATCAGG + Intronic
1168014401 19:53560616-53560638 GGTCTCACCGGGCTAAAACCAGG + Intronic
925704030 2:6667144-6667166 GCTCTCACTGGCCCATCTTCTGG - Intergenic
926427416 2:12751756-12751778 GGTCTCACTGGGTTAAAATCAGG + Intergenic
926838539 2:17051907-17051929 GCTCTGACAGGACCAAAAACTGG - Intergenic
931049959 2:58401650-58401672 GGTCTCACATGGCTAAAATCAGG + Intergenic
931185616 2:59948218-59948240 GCTCTCAATGGGACAAAATGCGG + Intergenic
931214569 2:60228916-60228938 AGTATCACTGGGCCAAAATGAGG - Intergenic
932179493 2:69632968-69632990 GCTCGCAGTGAGCCAAGATCAGG + Intronic
933189259 2:79314702-79314724 GATCACACTGAGCCAAAATGGGG - Intronic
933762836 2:85685032-85685054 GTTCTCACAAGGCCAAAGTCAGG - Intergenic
935446941 2:103167030-103167052 GCTCTCCCTGGGCCCATATGGGG + Intergenic
936506041 2:113108081-113108103 AGTCTTACTGGGCTAAAATCAGG + Intronic
939298260 2:140297921-140297943 GGTTTCACTGGGCCAAACTGTGG - Exonic
942330718 2:174821173-174821195 ACTTTCACTGGGCTAAAATCAGG + Intronic
942492995 2:176508684-176508706 GGTCTCACTGGTCTAAAATCAGG + Intergenic
947538089 2:230953548-230953570 AGTCTCACTGGGCTAAAATCAGG - Intronic
948419967 2:237852009-237852031 GATCTCACTAGACTAAAATCAGG - Intergenic
948608570 2:239152421-239152443 CCTCACCCTGGGCCGAAATCTGG + Intronic
1170413886 20:16120107-16120129 GGTCTCACTGGGCTAAAGTCAGG + Intergenic
1170892805 20:20390522-20390544 GCCCTAATTGGGCCAAAATGTGG - Intronic
1171056050 20:21908207-21908229 GCTCTCACTGGGGCAAACACAGG - Intergenic
1171106238 20:22435542-22435564 GATCTGACTGAGCCAAAAACAGG - Intergenic
1171186516 20:23127460-23127482 GCTCCCACTGGTCCCAACTCAGG - Intergenic
1176046488 20:63095443-63095465 GGTCTCCCTGGGCTAACATCAGG - Intergenic
1176636307 21:9247598-9247620 GCTCTCACTGTGTCAAAAAAAGG - Intergenic
1177770766 21:25513016-25513038 GGTCTCATTGAGCTAAAATCAGG - Intergenic
1178665576 21:34543479-34543501 AGTCTCAATGGGCTAAAATCAGG - Intronic
1179542864 21:42094945-42094967 GTTACCACTGGGCCTAAATCAGG + Intronic
1183199681 22:36377233-36377255 AATCTAACTGGGCCAGAATCGGG - Intronic
950112517 3:10428548-10428570 CCCCTCACTGGGCCAACACCTGG + Intronic
951515315 3:23552288-23552310 GGTTGCACTGGGCCAAGATCAGG + Intronic
952032616 3:29162548-29162570 GATCTCACATGGCCAAAATCAGG + Intergenic
953064551 3:39456880-39456902 GGCTTCACTGGGCTAAAATCAGG - Intergenic
954629008 3:52038245-52038267 GCTCAGCCTGGGCCAACATCAGG - Intergenic
955463224 3:59208490-59208512 GGTCTCACTGGACTAAAATCGGG - Intergenic
956182247 3:66528307-66528329 GGTCTCACTGGGCTACAATAAGG - Intergenic
956796487 3:72722942-72722964 GCTCTCACTGTGCCCAGTTCTGG + Intergenic
957150983 3:76485913-76485935 ACTCTCACTAGACCAAAATATGG + Intronic
959872594 3:111345548-111345570 GGTTTCACTGGGCTAAAATCAGG - Intronic
960134583 3:114092318-114092340 GCACTCAGTTGGCCAAAATAAGG - Intergenic
964723752 3:159793514-159793536 GGTCTTACAGGGCTAAAATCAGG + Intronic
965276519 3:166690248-166690270 GGTCTCACTGGGCTACAACCAGG + Intergenic
965957757 3:174391053-174391075 GCCTTCCCTGTGCCAAAATCTGG - Intergenic
967628642 3:191716134-191716156 GGTCTCACTGAGCTAAAATCAGG + Intergenic
968015781 3:195331392-195331414 GTTCTCAGTGAGCCAAGATCGGG - Intronic
968142390 3:196269092-196269114 GGTCTCAGAGGGCTAAAATCAGG - Intronic
970613545 4:17747071-17747093 GCTCTCAATGGGTCAAATCCAGG - Intronic
971232569 4:24811889-24811911 AATTTCACTGGGCCAAAACCAGG + Intronic
971449438 4:26786565-26786587 TATTTCACTGGGCCAACATCGGG + Intergenic
971747024 4:30595415-30595437 GCTCTCACAGGGATAAACTCAGG - Intergenic
972931066 4:44072084-44072106 GCTCTCCCTGGTCCAAAAGTGGG + Intergenic
973226552 4:47791368-47791390 GGTCTCACTGGGCAAAATTTAGG - Intronic
975498954 4:75063614-75063636 GATCTCACAAGGCCAAAGTCAGG + Intergenic
978317845 4:107459493-107459515 TCTCTCACTTGGGCAAAAGCTGG + Intergenic
979544990 4:121930224-121930246 GCCCTCTCTGAGCCAAAATTAGG - Intronic
980187431 4:129479759-129479781 GTTCTCACTGGGCTTATATCAGG + Intergenic
980486306 4:133461686-133461708 GCAATCACTGGGTCATAATCAGG + Intergenic
982278651 4:153662426-153662448 TCTCTCACTAGGCCATAACCAGG - Intergenic
982360350 4:154512651-154512673 TCTACCACTGGGCCAAAATAGGG + Intergenic
983363223 4:166754631-166754653 GCTCTGACTGGTCCAATAGCAGG + Exonic
983862318 4:172722951-172722973 GGTCTCACTGGGCTAAAATGAGG + Intronic
984874071 4:184352025-184352047 GGTCTCACTGGACTAAAATCAGG + Intergenic
984917190 4:184735372-184735394 GCTTGCAGTGAGCCAAAATCAGG - Intergenic
985289835 4:188376312-188376334 AGTATCAATGGGCCAAAATCAGG + Intergenic
1202751203 4_GL000008v2_random:6083-6105 GCTCTCACTGTGTCAAAAAAAGG - Intergenic
986949667 5:13068064-13068086 GCAGTCACTCAGCCAAAATCAGG - Intergenic
987360316 5:17100417-17100439 GATCTTACTGGGCTAAAATCAGG + Intronic
987833988 5:23137119-23137141 GATCTCACTGGGCTAAAATCAGG - Intergenic
989152899 5:38317825-38317847 CCTCATACTGGGCCAGAATCTGG - Intronic
993170446 5:84412504-84412526 AGTATCACTGGGCTAAAATCAGG - Intergenic
994780827 5:104087954-104087976 ACTTTCACTGGGCCAAAGCCAGG + Intergenic
995166464 5:109049268-109049290 GGTCTCACAAAGCCAAAATCAGG + Intronic
997927932 5:138047863-138047885 GGTCTCACTGGGCTAAAGTCAGG - Intronic
1002022556 5:176373231-176373253 GCTTTCACTGGGGAAAAATTGGG - Exonic
1003133154 6:3412951-3412973 GGTCTCACTGGTCTAAAGTCGGG - Intronic
1004487822 6:16084129-16084151 AGTATCACTGGGCCAAAATCAGG + Intergenic
1011262919 6:85487277-85487299 TCTCACACTGGGCTAAATTCTGG - Intronic
1012244784 6:96914204-96914226 GGTCTCACTGGGCTAATATCAGG - Intergenic
1012435554 6:99211625-99211647 GGTCTCACTGGGCTAAAACCAGG + Intergenic
1013981087 6:116130377-116130399 GCTCTCACTGGCCAAAAATGGGG - Intronic
1016355069 6:143209662-143209684 GGTCTCACTGGGCTAAAACAAGG - Intronic
1016912252 6:149210697-149210719 CCCCTCACTGGGCCACAGTCTGG - Intergenic
1017739831 6:157397360-157397382 GCTCTCCCTGGGCTACAATCAGG + Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018772407 6:166982906-166982928 GGTCTCACTGAGCTAAAACCAGG + Intergenic
1022463178 7:30631492-30631514 CCTCCCACTGAGCCAAAACCAGG + Exonic
1022482134 7:30751286-30751308 GCTCTGACTTGGCCACAAACCGG - Intronic
1023310434 7:38881154-38881176 GATCTCACTGGGCTAAAATCAGG + Intronic
1024347843 7:48330922-48330944 TTTTTCACTTGGCCAAAATCAGG - Intronic
1027149586 7:75723439-75723461 GGTCTCACTGGGCTAAAATTGGG + Intronic
1028398686 7:90401426-90401448 GGTCTCACTGTGCTAAAATCAGG - Intronic
1029358662 7:100072005-100072027 ACTGTCACTTGACCAAAATCTGG + Exonic
1030570056 7:111211932-111211954 GCTTGCAGTGAGCCAAAATCGGG + Intronic
1033208963 7:139446247-139446269 AGTCTCACTGAGCCAAAATCAGG + Intergenic
1036014896 8:4772037-4772059 GGTCTCACTGGGCTAAAACCAGG + Intronic
1037218832 8:16491026-16491048 GGTCACACTGGGCTAAAATCAGG - Intronic
1037884363 8:22588669-22588691 GCCCTCCCTGGGCCACACTCAGG - Intronic
1040597874 8:48858009-48858031 GGTCTCACTGGGCTAAAATTGGG - Intergenic
1040805685 8:51393858-51393880 GGTCTTGCTGGGCTAAAATCAGG - Intronic
1041213681 8:55578696-55578718 CCTATCACTGGTCAAAAATCTGG + Intergenic
1042449516 8:68928303-68928325 GCCCTCACTAGACCAAATTCTGG + Intergenic
1042875085 8:73434328-73434350 TGTCTCACTGGGCTAAAATCAGG - Intronic
1043514920 8:80986900-80986922 GGTCTCACTGGGCTAAAATCAGG - Intronic
1045245106 8:100435820-100435842 GGTCTCACTGGGCTAAAATTAGG + Intergenic
1045635195 8:104178156-104178178 AATCTCACAAGGCCAAAATCAGG + Intronic
1045860929 8:106814454-106814476 GATTTCACTGGGCTAAAATCAGG + Intergenic
1047751995 8:127888806-127888828 GGTCTCACTGAGCTAAAATCAGG - Intergenic
1059321618 9:113474838-113474860 GCTCCCACTGGGACACATTCCGG + Intronic
1061461926 9:130746895-130746917 AGTATCACTGGGCCAAAATCAGG + Intronic
1062486986 9:136783098-136783120 GCTTACACTGGGCCAAAAGAAGG - Intergenic
1185763495 X:2706295-2706317 GCTTGCAGTGAGCCAAAATCGGG + Intronic
1192495437 X:71613899-71613921 GGTGTCACTGGGCTAAAATCAGG + Intergenic
1197339693 X:125251468-125251490 GTTCTCACTGGGCTAAATTCAGG + Intergenic
1199694762 X:150336044-150336066 GGTCACACTGGGCTAAAATCAGG + Intergenic
1199903694 X:152203590-152203612 GGTCTCACTGTGCTAAAATCAGG + Intronic
1200223844 X:154405622-154405644 GCTCTCACTGGGCTCAGTTCTGG + Exonic