ID: 1141607541

View in Genome Browser
Species Human (GRCh38)
Location 16:85163331-85163353
Sequence TGCAACCGAGAAGTGCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141607541_1141607546 12 Left 1141607541 16:85163331-85163353 CCTCATGGCACTTCTCGGTTGCA No data
Right 1141607546 16:85163366-85163388 TTGGGCGCCGACTGCATGCCGGG No data
1141607541_1141607548 23 Left 1141607541 16:85163331-85163353 CCTCATGGCACTTCTCGGTTGCA No data
Right 1141607548 16:85163377-85163399 CTGCATGCCGGGTGCCCTCATGG No data
1141607541_1141607543 -7 Left 1141607541 16:85163331-85163353 CCTCATGGCACTTCTCGGTTGCA No data
Right 1141607543 16:85163347-85163369 GGTTGCACGCTGGTTAGTATTGG No data
1141607541_1141607544 -6 Left 1141607541 16:85163331-85163353 CCTCATGGCACTTCTCGGTTGCA No data
Right 1141607544 16:85163348-85163370 GTTGCACGCTGGTTAGTATTGGG No data
1141607541_1141607545 11 Left 1141607541 16:85163331-85163353 CCTCATGGCACTTCTCGGTTGCA No data
Right 1141607545 16:85163365-85163387 ATTGGGCGCCGACTGCATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141607541 Original CRISPR TGCAACCGAGAAGTGCCATG AGG (reversed) Intergenic
No off target data available for this crispr