ID: 1141608881

View in Genome Browser
Species Human (GRCh38)
Location 16:85170270-85170292
Sequence AGTCCGGGGTTAGGCGCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141608873_1141608881 -3 Left 1141608873 16:85170250-85170272 CCACGCGGATGGGGAGCCCAAGT No data
Right 1141608881 16:85170270-85170292 AGTCCGGGGTTAGGCGCCGGCGG No data
1141608867_1141608881 8 Left 1141608867 16:85170239-85170261 CCCGCGAAGGCCCACGCGGATGG No data
Right 1141608881 16:85170270-85170292 AGTCCGGGGTTAGGCGCCGGCGG No data
1141608872_1141608881 -2 Left 1141608872 16:85170249-85170271 CCCACGCGGATGGGGAGCCCAAG No data
Right 1141608881 16:85170270-85170292 AGTCCGGGGTTAGGCGCCGGCGG No data
1141608869_1141608881 7 Left 1141608869 16:85170240-85170262 CCGCGAAGGCCCACGCGGATGGG No data
Right 1141608881 16:85170270-85170292 AGTCCGGGGTTAGGCGCCGGCGG No data
1141608866_1141608881 9 Left 1141608866 16:85170238-85170260 CCCCGCGAAGGCCCACGCGGATG No data
Right 1141608881 16:85170270-85170292 AGTCCGGGGTTAGGCGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141608881 Original CRISPR AGTCCGGGGTTAGGCGCCGG CGG Intergenic
No off target data available for this crispr