ID: 1141611191

View in Genome Browser
Species Human (GRCh38)
Location 16:85182089-85182111
Sequence AAGGCTGTTCACACCAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141611186_1141611191 0 Left 1141611186 16:85182066-85182088 CCAGGCTGCGCGGCATCCCCAGC 0: 1
1: 0
2: 4
3: 18
4: 244
Right 1141611191 16:85182089-85182111 AAGGCTGTTCACACCAAGCATGG 0: 1
1: 0
2: 1
3: 12
4: 145
1141611183_1141611191 26 Left 1141611183 16:85182040-85182062 CCAGAATGTGGCTTCGTGCTCTG 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1141611191 16:85182089-85182111 AAGGCTGTTCACACCAAGCATGG 0: 1
1: 0
2: 1
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141611191 Original CRISPR AAGGCTGTTCACACCAAGCA TGG Intronic
900075104 1:808149-808171 AGGGCTATTTAAACCAAGCATGG - Intergenic
903264251 1:22147493-22147515 AAGGCTGTTCACCCTGACCAGGG + Intergenic
903810554 1:26032816-26032838 CAGGTGGTTCACACCAACCACGG - Intronic
904741785 1:32682991-32683013 AAGTCTGTTTAGGCCAAGCATGG + Exonic
904902302 1:33867004-33867026 AAGGGTGTGAACACCAAGAAAGG - Intronic
906705022 1:47888427-47888449 CAGGCTGTTCACCCCATACAAGG + Intronic
907393473 1:54174011-54174033 GAAGCTGTTCACAGCAAGAAAGG + Intronic
907890365 1:58631094-58631116 AAGGCTGATCACCCCAAGAGTGG - Intergenic
915123878 1:153649801-153649823 AAGGCAGTTCAACCTAAGCATGG + Intergenic
917753698 1:178078129-178078151 GAGGATATTCAAACCAAGCAAGG + Intergenic
918122441 1:181551294-181551316 GAGGCTCTTCAATCCAAGCAGGG - Intronic
920903107 1:210132162-210132184 AAGGCTCTACACCCCAGGCAAGG + Intronic
922270944 1:224033048-224033070 AGGGCTATTTAAACCAAGCATGG - Intergenic
923141743 1:231166043-231166065 ACTGCTGTTGACACCAAGCCAGG - Intronic
923519255 1:234723255-234723277 AAGGCCGTCCACAGCCAGCATGG + Intergenic
1063874265 10:10455976-10455998 AATCCTGTTGCCACCAAGCAAGG + Intergenic
1065993681 10:31036536-31036558 AAGGCTGTCCCCAACAAGAAGGG + Intergenic
1066349364 10:34623241-34623263 AAGGCTGTTCCCACCCATGAAGG + Intronic
1068941146 10:62682733-62682755 AAGTGTGATCACACCAAGCTTGG + Intergenic
1069782851 10:70967781-70967803 AAGGCTGTTCACCCCCTGCCTGG + Intergenic
1070748511 10:78949863-78949885 CTGGCTGTTCACACCAGGAAGGG - Intergenic
1071285639 10:84141608-84141630 ATGGCTGTTAACACCTAGCAGGG + Exonic
1072668636 10:97413028-97413050 GTGGCTGTTCAGGCCAAGCAAGG + Intronic
1072680640 10:97503720-97503742 ACGTCTGTTCACAGCCAGCAGGG - Intronic
1075846826 10:125551641-125551663 AAGGCTGTCTGCACCAGGCAAGG + Intergenic
1077073431 11:688552-688574 CTGGCTGTTCTCACCAAGAAGGG + Intronic
1077266497 11:1653321-1653343 AAGACTGTTCAGACCAGGCCAGG - Intergenic
1080643728 11:34173531-34173553 AAGGCTGATCACCCCTTGCAAGG + Intronic
1084455922 11:69268134-69268156 GAGGCTGTGCCCACCAGGCAAGG + Intergenic
1085510260 11:77084551-77084573 AAGGCTGGTCAAACAAAGGAAGG + Intronic
1085700132 11:78738501-78738523 ACTGATGTTCACACCAACCAGGG + Exonic
1087305489 11:96484684-96484706 AAGGCACATCACACCATGCAGGG - Intronic
1089035614 11:115387124-115387146 AAGGCTGGTCACAAGAATCAAGG + Intronic
1090533717 11:127618052-127618074 AACTCTGTTTACACCTAGCATGG + Intergenic
1094646425 12:32328910-32328932 AAGGCAGGTTACACCAACCAGGG + Intronic
1098432928 12:70440352-70440374 AAGGCTGTTCACAAAAAGTGAGG - Intergenic
1104783444 12:131434867-131434889 AGGGTTGGACACACCAAGCAAGG - Intergenic
1111062018 13:83033516-83033538 TAGGCTGTTTCCACCAGGCACGG + Intergenic
1111956912 13:94769245-94769267 AAGGTTGTTCACAGTCAGCAGGG - Intergenic
1112532656 13:100220041-100220063 AAGGCTGTTCACAAGAAGTGAGG + Intronic
1113448610 13:110389497-110389519 AATGCTGACCACATCAAGCATGG - Intronic
1115534901 14:34363811-34363833 CAGGCTGTGCACACCACGCCTGG - Intronic
1116807376 14:49507232-49507254 TAGGCTGCTGACACCATGCAAGG - Intergenic
1117843545 14:59886468-59886490 AAAGCACTTCACACCATGCAAGG + Intergenic
1119211242 14:72833687-72833709 CAGGCTGGTCACACCATGCTGGG + Intronic
1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG + Intronic
1121314175 14:92951350-92951372 AAGGCTGTTCACACGGTGCAAGG - Intronic
1122162808 14:99797967-99797989 AAGGCTGTTCAAAGCTAGAAAGG + Intronic
1124867717 15:33509709-33509731 CAGGCTTTTAACACCTAGCATGG - Intronic
1125477496 15:40057119-40057141 AAGGTTGTTTACTGCAAGCATGG + Intergenic
1128240294 15:66096810-66096832 AAGGCTGTTCCCCCCCAGCTTGG - Intronic
1128760139 15:70210888-70210910 AAGGCAGGTGATACCAAGCATGG - Intergenic
1129726590 15:77904607-77904629 CCGGCTGTTCTCACCCAGCAGGG + Intergenic
1131073477 15:89480247-89480269 ATGGCAGTTCTCACCAATCATGG + Exonic
1131168716 15:90161416-90161438 AAGTCTGGTGACACCAAACAGGG + Intronic
1131712292 15:95068917-95068939 AGGGCTGTTCACGCCAAGACTGG - Intergenic
1131728446 15:95252860-95252882 TAAGCTGTGCACAGCAAGCAAGG + Intergenic
1138125625 16:54436150-54436172 AAGGCTGTTGACCACAAGGATGG - Intergenic
1138584631 16:57962059-57962081 GAGGCAGTTGAAACCAAGCAGGG + Intronic
1141611191 16:85182089-85182111 AAGGCTGTTCACACCAAGCATGG + Intronic
1142229429 16:88892906-88892928 CAGGCCCTTCACACCCAGCAGGG + Intronic
1144638353 17:16924775-16924797 CAGGCTGTTCACCCCATGCCAGG + Intergenic
1154163002 18:11993857-11993879 AAGGCCCTTCACACCCAGCCAGG - Intronic
1165134641 19:33660087-33660109 AAGGCTGGTCAGACACAGCAAGG - Intronic
1166202639 19:41248502-41248524 CAGGCTGTTCACTGCATGCAAGG - Exonic
925143270 2:1564532-1564554 AAGGTTGTTCTCACCGACCACGG - Intergenic
925533796 2:4894170-4894192 TAGGCTGTTCACACAAACCTGGG + Intergenic
925608555 2:5683869-5683891 AAGGGTGTTCACACCTAGGAAGG + Intergenic
928584692 2:32746996-32747018 AGGTCAGTTCAGACCAAGCAGGG + Intronic
931998831 2:67864962-67864984 AATGCTGGTCACACAAAGAATGG - Intergenic
935202350 2:100869224-100869246 AAGCATGTTTAGACCAAGCATGG - Intronic
936621799 2:114107866-114107888 AAGGCTGTTCACAATGAGCAAGG + Intergenic
937360169 2:121224163-121224185 AAGCCTGTGGACACCAAGTACGG - Exonic
937483128 2:122283560-122283582 AAGGTTGTTCACACAAAATAAGG - Intergenic
938382491 2:130844380-130844402 AGGGCTGTGCCCACCAGGCAGGG - Intronic
942777250 2:179597110-179597132 AAGTCTGTTCAAAGCAATCAAGG + Intronic
943284076 2:185974621-185974643 ATGCCTGTTCACACTAATCAAGG - Intergenic
943733477 2:191328284-191328306 AGAGCTGTTCACACCAGTCAAGG - Intronic
943949211 2:194108133-194108155 AAGACTGATAACACCAAGTATGG - Intergenic
945974137 2:216257795-216257817 AAGGCTGTTTACACCACAGAGGG + Intergenic
946327411 2:218992011-218992033 AAGGCTGTTCAAGCCCTGCATGG - Intronic
946351547 2:219158265-219158287 AAGGTTTTTATCACCAAGCAGGG - Exonic
948864263 2:240767478-240767500 CAGGCTGGTCACTCCAAGCCAGG + Intronic
949082618 2:242116635-242116657 AGGGCTATTTAAACCAAGCATGG + Intergenic
1168989908 20:2086237-2086259 GAGGCCATTCAGACCAAGCACGG + Intergenic
1169388758 20:5172670-5172692 AAGGCTCTTCAGACCTTGCAGGG + Intronic
1172505877 20:35462304-35462326 GAGGGTGTTCACGCCCAGCAGGG - Exonic
1173430471 20:42983135-42983157 AAGGATGTGCACACAAAGGATGG - Intronic
1173969273 20:47138851-47138873 AAGGCTGTACACAAAAAGAAAGG - Intronic
1173985853 20:47260737-47260759 AAGGCAGTTCACACCATGAGAGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1180593826 22:16961219-16961241 AAGTCTGTTCACCCCAAGGTAGG + Intergenic
1182736277 22:32533812-32533834 AAGGCTGTCCACAGCAAGGATGG - Exonic
1184475096 22:44716044-44716066 AATGCTGTTCACACCAAGGAGGG - Intronic
949852102 3:8429889-8429911 AAAGCTGTTGCCATCAAGCAGGG - Intergenic
950693269 3:14677789-14677811 AAGGATGTTCAGGCCAGGCATGG - Intronic
954094529 3:48314656-48314678 AAGGCTGTTTGCACCAAGAGAGG - Intronic
955243525 3:57202628-57202650 AAGTCTGTTGAGGCCAAGCATGG - Intronic
962492549 3:135908405-135908427 AAGGCTGTTCCCACCCAGTGAGG - Intergenic
963938120 3:151075231-151075253 AATGCTGTTGTCACCAAGAAGGG + Intergenic
963946227 3:151148524-151148546 CAGGCTGTTCACACTCAGAAGGG + Intronic
971356629 4:25901028-25901050 AAGGCTTCTCAGCCCAAGCAGGG - Intronic
972541717 4:40044738-40044760 CAGGCTCTTGACACCAAGCCTGG + Intergenic
973863818 4:55091856-55091878 AAGGTTGTAAACACCAAGCGGGG - Intronic
974077994 4:57185170-57185192 ATGGCTGTGCACACCAACCTTGG - Intergenic
976449382 4:85169532-85169554 AGGGCTGTTCACACAAAGGCTGG + Intergenic
977645424 4:99406432-99406454 AATGCTGCGCACACCATGCAGGG - Intergenic
980077287 4:128307336-128307358 AAGGCTGTTCTCAGCCATCATGG - Intergenic
980106082 4:128589798-128589820 AAGGCATTACACACCATGCAAGG + Intergenic
987841882 5:23232815-23232837 AAAGCTGTTCCCATCAAGGATGG + Intergenic
988135205 5:27161357-27161379 ATGGCTGTTCACAACAGCCAAGG + Intergenic
991188830 5:63844275-63844297 AAGGGTGGCCACACCAAGCATGG + Intergenic
994267265 5:97732873-97732895 AAGACATTTCAAACCAAGCATGG - Intergenic
995907986 5:117149507-117149529 AAGGCTGGCCACAGAAAGCAGGG - Intergenic
997720878 5:136077635-136077657 AAGGGTGCTCACAGAAAGCAGGG + Intergenic
998430963 5:142069551-142069573 AATACTGTTCCCACCAGGCATGG - Intergenic
1000609593 5:163359745-163359767 AAGGCTGCACACAGCAAGGAGGG - Intergenic
1001487296 5:172128730-172128752 AAGGAACTTCACAACAAGCAGGG - Intronic
1001987187 5:176084567-176084589 AAGGCATTTCACATCAAGCCTGG + Intronic
1002229681 5:177753580-177753602 AAGGCATTTCACATCAAGCCTGG - Intronic
1003521012 6:6858460-6858482 AAGGCTATTCATACCAAGTCAGG - Intergenic
1010364704 6:75036268-75036290 TAGTATGTTCACAGCAAGCACGG - Intergenic
1011754743 6:90486962-90486984 GAGACTGGCCACACCAAGCAGGG - Intergenic
1011795502 6:90947741-90947763 AAGTCTGTGCACACCCAGCCAGG - Intergenic
1014092588 6:117420838-117420860 AAGGCTGTTAACAGCAAGTTGGG - Intronic
1015782787 6:136887386-136887408 AAGGCTGTTCCCACAGAGCCTGG + Intronic
1015813826 6:137187113-137187135 AAGTCTGTTTACCCCAAGAAAGG - Intergenic
1018251597 6:161877270-161877292 GAGGCTGTCCTCACCTAGCAGGG - Intronic
1019181212 6:170188207-170188229 GAGGCTGGTCCCACCATGCATGG + Intergenic
1021412467 7:20343900-20343922 AATGATGTACTCACCAAGCAAGG - Intronic
1022469720 7:30674803-30674825 AATCCTGCTCACACCAAGAATGG - Intronic
1024997379 7:55282781-55282803 AAAGCTGTTCACATCAAGGATGG + Intergenic
1026183864 7:68065820-68065842 ACCACTGATCACACCAAGCATGG - Intergenic
1027231857 7:76277225-76277247 ATGGCTGTTCACCCCCATCATGG - Intronic
1027526020 7:79269822-79269844 AAGGCTGTTTTCAGCAAGGAGGG - Intronic
1032413591 7:131719096-131719118 AAGGCCTTTCACACCCAGCAAGG - Intergenic
1033850038 7:145483779-145483801 AAAGCTGTTCACATCAAGGATGG + Intergenic
1034257338 7:149731827-149731849 AAGGCTGTTTTCCCCAAGCTGGG - Intronic
1034294793 7:149962785-149962807 GAGGATGTGCACACAAAGCAAGG - Intergenic
1034811269 7:154134167-154134189 GAGGATGTGCACACAAAGCAAGG + Intronic
1034846214 7:154448018-154448040 AAGGATGTTCATTCCCAGCATGG + Intronic
1036007984 8:4688786-4688808 AGAGCTGTTCTCACAAAGCACGG - Intronic
1044069680 8:87741956-87741978 AAGGATGTTCAAACCAATCTTGG + Intergenic
1044643974 8:94418365-94418387 AATGATATTCCCACCAAGCAAGG + Intronic
1052843060 9:33309781-33309803 ATTGATGTTCACACCAGGCATGG - Intronic
1055772127 9:79728663-79728685 AAGACTGTGCACATCAAGCCAGG - Intergenic
1055989937 9:82094642-82094664 AAGGCTGTTGAAGCAAAGCAAGG - Intergenic
1060407846 9:123381646-123381668 AGGGCTGCTGAGACCAAGCAGGG - Exonic
1061785396 9:133024883-133024905 AAAAATGTTCAAACCAAGCAGGG + Intergenic
1203426957 Un_GL000195v1:49949-49971 AAGCCTACTCACACCAATCATGG + Intergenic
1186211787 X:7257305-7257327 ACCGCTGTGCACACCAAGCAGGG + Exonic
1190899888 X:54661060-54661082 AAGGCTGTACACATGAAGAAAGG + Intergenic
1192898011 X:75464600-75464622 AAAGCTATTCACAACAATCAAGG + Intronic
1199233555 X:145466795-145466817 AAAGCTGTTCACATCAAGGATGG + Intergenic
1201584915 Y:15549674-15549696 ACCGCTGTGCACACCAAGCAGGG + Intergenic