ID: 1141611259

View in Genome Browser
Species Human (GRCh38)
Location 16:85182322-85182344
Sequence CTGGAGCCTGCCTGGTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 385}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141611259_1141611271 13 Left 1141611259 16:85182322-85182344 CCAAGAAACCAGGCAGGCTCCAG 0: 1
1: 0
2: 4
3: 32
4: 385
Right 1141611271 16:85182358-85182380 GCTCGGGCCTGGCCTTCAGGTGG 0: 1
1: 0
2: 2
3: 23
4: 310
1141611259_1141611270 10 Left 1141611259 16:85182322-85182344 CCAAGAAACCAGGCAGGCTCCAG 0: 1
1: 0
2: 4
3: 32
4: 385
Right 1141611270 16:85182355-85182377 GAGGCTCGGGCCTGGCCTTCAGG 0: 1
1: 0
2: 3
3: 32
4: 374
1141611259_1141611269 2 Left 1141611259 16:85182322-85182344 CCAAGAAACCAGGCAGGCTCCAG 0: 1
1: 0
2: 4
3: 32
4: 385
Right 1141611269 16:85182347-85182369 GATGGGAGGAGGCTCGGGCCTGG 0: 1
1: 0
2: 6
3: 77
4: 517
1141611259_1141611268 -3 Left 1141611259 16:85182322-85182344 CCAAGAAACCAGGCAGGCTCCAG 0: 1
1: 0
2: 4
3: 32
4: 385
Right 1141611268 16:85182342-85182364 CAGAGGATGGGAGGAGGCTCGGG 0: 1
1: 0
2: 10
3: 101
4: 823
1141611259_1141611267 -4 Left 1141611259 16:85182322-85182344 CCAAGAAACCAGGCAGGCTCCAG 0: 1
1: 0
2: 4
3: 32
4: 385
Right 1141611267 16:85182341-85182363 CCAGAGGATGGGAGGAGGCTCGG 0: 1
1: 1
2: 7
3: 95
4: 774
1141611259_1141611265 -9 Left 1141611259 16:85182322-85182344 CCAAGAAACCAGGCAGGCTCCAG 0: 1
1: 0
2: 4
3: 32
4: 385
Right 1141611265 16:85182336-85182358 AGGCTCCAGAGGATGGGAGGAGG 0: 1
1: 0
2: 8
3: 60
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141611259 Original CRISPR CTGGAGCCTGCCTGGTTTCT TGG (reversed) Intronic
900579872 1:3403613-3403635 CTGGCTCCTGCCTGGTCTCAGGG - Intronic
900622965 1:3595850-3595872 CTGGAGCCAGAATGGCTTCTGGG + Intronic
901216862 1:7559916-7559938 CCGGAACCTGTCTGGGTTCTTGG + Intronic
901660500 1:10795609-10795631 CTGGAGCCCGCCTGGGTCCCGGG - Intronic
901674515 1:10875128-10875150 CTGGACGCTCCCTGGTATCTGGG - Intergenic
901815320 1:11790338-11790360 CTGGAGGCTGCCTTGGTTCGAGG + Exonic
902540854 1:17153481-17153503 CTGGCATCTGCTTGGTTTCTGGG - Intergenic
902838208 1:19060040-19060062 CTGGAGCCTGGGTGAGTTCTGGG - Intergenic
902994770 1:20215490-20215512 CTAGAGCCTGCCTGATGTGTGGG - Intergenic
903186465 1:21632080-21632102 CTGGAGCCAACCTGGAGTCTGGG + Intronic
903186825 1:21633803-21633825 CTGGGGTCTTCCTGGTTTCCAGG + Intronic
903293249 1:22327936-22327958 CTAGAGTCAGCCTGGGTTCTGGG + Intergenic
904405736 1:30286862-30286884 CAGGAGCCTGCCTGATGGCTAGG - Intergenic
904832920 1:33316758-33316780 CCTGAGCCTGCCTGCCTTCTGGG - Intronic
905459630 1:38114158-38114180 CTGGAGCCAGCCTGGAACCTGGG + Intergenic
906412416 1:45589413-45589435 CTGCACCCAGTCTGGTTTCTGGG + Intronic
907268389 1:53276385-53276407 CCTGAGCCTGCCAGGTTTCTGGG + Intronic
908114008 1:60923774-60923796 CCGGAGCCTGGCTGTGTTCTGGG + Intronic
908411627 1:63871622-63871644 CTGGAGCCTGTATGGTTGCCTGG - Intronic
909173379 1:72322585-72322607 CTGGATCCTGCATTGTGTCTTGG - Intergenic
910118707 1:83760900-83760922 CTGGAGGCTCCCTGGTGCCTGGG + Intergenic
910160649 1:84268911-84268933 CTAGAGGCTGCCTGTATTCTTGG - Intergenic
910589124 1:88910538-88910560 CTGGAGCATGCCTGGTGTTCAGG + Intergenic
911262401 1:95701857-95701879 CTGGAGCAGGCCTGGACTCTAGG - Intergenic
913100711 1:115561867-115561889 CTGGAGTCTTCTTGGCTTCTAGG - Intergenic
913372594 1:118117323-118117345 GTGAAGCCTGCCTGGTGTCATGG + Intronic
915344202 1:155190487-155190509 CTGGGGCCGGCCTGGTGTCCGGG + Intronic
915344351 1:155190847-155190869 CCGGGGCCGGCCTGGTGTCTGGG + Intronic
915568782 1:156732486-156732508 CTGGAGCATGGGTGGTGTCTGGG + Intronic
916343781 1:163765755-163765777 CTGGCATCTGCTTGGTTTCTAGG + Intergenic
918918952 1:190680320-190680342 CTGGAGCCTGCTTGTTTACCTGG - Intergenic
919808466 1:201394868-201394890 CTGGAGCCTCCAGGGTTCCTGGG + Intronic
923104379 1:230843263-230843285 CTGTGGCCTGCCTGCTTTGTGGG + Intronic
923281114 1:232443656-232443678 CTGGAGGATGACTGGTTGCTGGG + Exonic
1064162396 10:12957763-12957785 CTGGCACCTGCTTGGCTTCTGGG - Intronic
1065414950 10:25474133-25474155 CTAGAGGCTGCCTGCATTCTTGG - Intronic
1065502079 10:26392276-26392298 CAGGAACATCCCTGGTTTCTGGG - Intergenic
1065622593 10:27599145-27599167 GTGGATCCTGCCTGGTATCTGGG + Intergenic
1065971891 10:30812348-30812370 CTGCAGCCTCTCTGGTTTCTTGG - Intergenic
1067008827 10:42691145-42691167 CTGGAGCCTGGCTCCTTCCTTGG + Intergenic
1067038219 10:42934334-42934356 CTGGACCCTGCCAGGTTTGGGGG - Intergenic
1067414214 10:46091488-46091510 CTGGAGCCCTCCTGGTTTCTTGG + Intergenic
1067434265 10:46266003-46266025 CTGGAGCCCTCCTGGTTTCTTGG + Intergenic
1067527824 10:47048850-47048872 CTGCAGCTGGCCGGGTTTCTAGG + Intergenic
1069405336 10:68092912-68092934 CTCGAACCTGCTTGTTTTCTTGG + Intergenic
1069743915 10:70702855-70702877 AGGGAGGCTGCCTGGTGTCTGGG + Intronic
1070472427 10:76796036-76796058 CTAGAGGCTGCCTGTATTCTTGG - Intergenic
1070483961 10:76912061-76912083 CTGGACCCTGGCTGGTCTCTTGG - Intronic
1071430151 10:85600974-85600996 CTGGAGCCAGCCCTGTTTGTTGG + Exonic
1072346397 10:94511830-94511852 CTTGAGGCTGCCAGCTTTCTGGG + Intronic
1074823269 10:117197383-117197405 CTGGAGCCTGGCTGTTCTCCGGG + Intergenic
1075017472 10:118920618-118920640 CTGGCACCTGCTTGGCTTCTGGG - Intergenic
1075395733 10:122125675-122125697 TTGGTGCCTGCCAGGTTTATTGG + Intronic
1075713801 10:124544433-124544455 CTGGAGCCTGCCTGGACACCTGG - Intronic
1076828818 10:132983886-132983908 CCGTAGCCTGCGTGGGTTCTGGG + Intergenic
1077211806 11:1374650-1374672 CTGGTGTCTGCTTGGCTTCTGGG - Intergenic
1078134686 11:8641928-8641950 CTGGAACCTGCTCGGCTTCTGGG - Intronic
1079228970 11:18633435-18633457 GTGGAGAGCGCCTGGTTTCTGGG - Intronic
1079249729 11:18778686-18778708 CTGGTGTCTGCTTGGCTTCTAGG - Intronic
1079897713 11:26143103-26143125 CTGGAGCTTCCCTGGTTTTCAGG + Intergenic
1081435789 11:43026238-43026260 CTAGATCCTGCCTGGTTTTTAGG - Intergenic
1082105244 11:48214583-48214605 CAGGATCCTACATGGTTTCTTGG + Intergenic
1083001481 11:59296304-59296326 GTAGAGCCTGCATGCTTTCTTGG - Intergenic
1083298435 11:61727682-61727704 GTGGAGCCTGCCAGGTCTCAGGG - Intronic
1083622316 11:64055342-64055364 CTGGAAGCAGCCCGGTTTCTGGG + Intronic
1083770234 11:64863140-64863162 CCGGAGCCTGACTGCTCTCTGGG - Intronic
1084118674 11:67056562-67056584 CTGGCTCCTGCCTGGGATCTGGG + Intergenic
1084564897 11:69923105-69923127 CTGGAGCCAGACTGCATTCTAGG - Intergenic
1084910051 11:72381270-72381292 CTGGAGTGGGCCTGGTTTCAGGG - Intronic
1085710738 11:78826925-78826947 ATGTCACCTGCCTGGTTTCTAGG + Intronic
1085762130 11:79250592-79250614 ATGGAGGATGCCTGGTTTCCAGG + Intronic
1088814446 11:113411623-113411645 CTGGAGACTGAATGGTGTCTGGG + Intronic
1089398647 11:118152163-118152185 CTGGTGCATGCCTGGTGCCTGGG + Intronic
1089398709 11:118152451-118152473 CTGGTTCCTGCCTGGTTCATAGG - Intronic
1090564331 11:127970690-127970712 CTGAAGTCTGCTTGGCTTCTGGG - Intergenic
1091385866 12:94283-94305 CAGGAGCCTGCCTGGGGTTTAGG + Intronic
1092118636 12:6027645-6027667 CCGGAGGCTGCCTGCATTCTTGG - Intronic
1093347556 12:18057465-18057487 CTGGTGCCATCCTGGTTTCTGGG - Intergenic
1093938320 12:25025359-25025381 CTGCAGCCTGCCTGCTATTTTGG + Intronic
1095983635 12:47986108-47986130 CTGGAGCCTGCCCCGCTTCCTGG + Intronic
1096122136 12:49094945-49094967 CAGGTGTCTGCCTGGTTTCCAGG - Intergenic
1096542477 12:52315717-52315739 CCATACCCTGCCTGGTTTCTTGG - Intronic
1097499872 12:60388673-60388695 CTGGACCCTCCCTGCTTTATGGG - Intergenic
1098101177 12:67018612-67018634 CTGGTTTCTGCCTGGTTTGTAGG - Intergenic
1099984541 12:89647969-89647991 CTGGCATCTGCCTGGCTTCTAGG - Intronic
1101281685 12:103263902-103263924 CTGGAACCTGGCTGATGTCTGGG + Intronic
1101750340 12:107578314-107578336 CTGGAGCTTGCCAGCTGTCTTGG + Intronic
1102278466 12:111599765-111599787 CTGGGGCCTGCCTGGTGTGGAGG + Intergenic
1102686960 12:114732379-114732401 ATGGGGCCTGACTGGGTTCTAGG + Intergenic
1102998462 12:117367232-117367254 CTGTAGCCTTCCTGTTTTCCCGG + Intronic
1103222723 12:119259363-119259385 CTGCAGCCTGCCTGGGCTGTGGG - Intergenic
1103921824 12:124403205-124403227 CTGGGGCCTTCCTGGGCTCTGGG - Intronic
1103981174 12:124737956-124737978 CTGAGGCCTGCTTGGCTTCTTGG - Intergenic
1104225126 12:126824020-126824042 CTGGCACCTGCTTGGTTTCTAGG - Intergenic
1105777121 13:23673461-23673483 CTGGACCTTGCATGGCTTCTGGG + Intronic
1106200052 13:27528475-27528497 CTGGCATCTGCCTGGCTTCTGGG - Intergenic
1107096585 13:36544131-36544153 CTGGAACCTTCATGCTTTCTTGG + Intergenic
1109139476 13:58696167-58696189 CTGGCATCTGCTTGGTTTCTTGG - Intergenic
1109942414 13:69387917-69387939 CTTGAGCCTGCCTGGGAGCTGGG - Intergenic
1113167794 13:107462604-107462626 CTGGCCCCTGCCTGGCTCCTGGG + Intronic
1113328424 13:109306160-109306182 CTGGAGCATGCCAGGATTCTGGG - Intergenic
1113472425 13:110556361-110556383 CTGGAGCCTGCCTGATTTCCTGG - Intronic
1113653652 13:112055516-112055538 CTGGAGCCACACTTGTTTCTCGG - Intergenic
1115116181 14:29883037-29883059 CTGGCATCTGCCTGGCTTCTGGG + Intronic
1115895636 14:38084007-38084029 CTGGATCCTGCATGTTTTTTTGG - Intergenic
1117331766 14:54719457-54719479 ATGGAGGCGGCCTGGTTTCTAGG + Intronic
1118149921 14:63178629-63178651 CTGCTACCTGCCTGGTATCTTGG - Intergenic
1118438242 14:65790483-65790505 CTGATGCCTGCCTGGTCACTTGG + Intergenic
1118520262 14:66575669-66575691 CTGGAGCAGGCCTGGATCCTGGG + Intronic
1118550748 14:66947100-66947122 CTGGCTCCTCCCTGATTTCTAGG + Intronic
1119521308 14:75287960-75287982 CTGGAGCCTGCCTGGCCTTATGG + Intergenic
1120902536 14:89588250-89588272 CTGGCGTCTGCTTGGTTTCTGGG - Intronic
1121696647 14:95918742-95918764 ATGGAGGCTGCTTGGTTTCAAGG - Intergenic
1124001886 15:25766988-25767010 CTTTGCCCTGCCTGGTTTCTTGG + Intronic
1124343166 15:28902972-28902994 ATGCAGCCTGCCTGGGTGCTGGG + Intronic
1124992622 15:34691103-34691125 CAGCAGCCTCCCTGCTTTCTTGG + Intergenic
1125246876 15:37650597-37650619 ATGGATCCTGTCTGGTTCCTGGG - Intergenic
1125259563 15:37807565-37807587 CAGGAGCTTGACTGGTTCCTGGG + Intergenic
1127094412 15:55498369-55498391 CTTGCGCCTGCTTGGTTGCTAGG + Exonic
1129062722 15:72873204-72873226 CTAGAGACTGCCTGCTTCCTTGG - Intergenic
1129252405 15:74316167-74316189 CTGGGGCCTCCCTGGCTTCATGG + Intronic
1129664584 15:77572409-77572431 CTGGAGGGTCCCTGGGTTCTGGG + Intergenic
1131682279 15:94736675-94736697 CTGGAGACTGCTTGGATTCAGGG - Intergenic
1132589983 16:722349-722371 CTGGGGCCCGCGTGGTGTCTGGG + Exonic
1132660742 16:1060492-1060514 CTGGAGCCTGGGTGGCCTCTAGG + Intergenic
1132825627 16:1903941-1903963 CTGGAGGCTGCCTGTCTGCTGGG - Intergenic
1133522394 16:6571583-6571605 CTGTTGCTTGCCTGTTTTCTAGG + Intronic
1133911212 16:10068363-10068385 CTGGCATCTGCCTGGCTTCTGGG + Intronic
1134858757 16:17542124-17542146 CTGGAGCCAGCCAGCTTTCTCGG - Intergenic
1135552084 16:23406195-23406217 CCGGAGCCTGGCTGGTTTTCAGG - Exonic
1137437786 16:48471616-48471638 CTGGAGCCTGCCAGGCAGCTTGG + Intergenic
1139152272 16:64397014-64397036 CTGGCATCTGCTTGGTTTCTGGG + Intergenic
1139405351 16:66713305-66713327 CTGGCAACTGCCTGATTTCTTGG - Intergenic
1139491394 16:67288010-67288032 CTGTAGCCTGCCTGCTACCTCGG - Exonic
1139651631 16:68365198-68365220 CTGGCTCCTGGCTGGATTCTGGG + Intronic
1140716977 16:77735455-77735477 CTGGCGTCTGCTTGGCTTCTGGG - Intronic
1140864099 16:79044576-79044598 CTGGCAGCTGCCTGGCTTCTGGG - Intronic
1140944085 16:79751251-79751273 CTGGAGTCTACCTGGATTCCTGG - Intergenic
1141611259 16:85182322-85182344 CTGGAGCCTGCCTGGTTTCTTGG - Intronic
1142438609 16:90078672-90078694 CTGGCACCTGCTTGGCTTCTTGG + Intronic
1143140804 17:4740795-4740817 CTGGGGACTGCCTGGCTCCTGGG + Exonic
1143977126 17:10838092-10838114 CTGGAGCCTGCTCAGTTGCTGGG - Exonic
1144992390 17:19242539-19242561 CTGGAGCCTGCTTCGTTCCTGGG + Intronic
1145140625 17:20446980-20447002 CTGGGGCCTCCCTGGTCCCTTGG + Intergenic
1145260076 17:21349367-21349389 CTGGATCCTGCCTGATTCCGTGG + Intergenic
1145316542 17:21738571-21738593 CTGGATCCTGCCTGATTCCGTGG - Intergenic
1145714965 17:27010478-27010500 CTGGATCCTGCCTGATTCCGTGG - Intergenic
1145795245 17:27651691-27651713 CTGGGGCCTTCCTGGTCCCTTGG - Intergenic
1145809682 17:27757014-27757036 CTGGGGCCTCCCTGGTCCCTTGG - Exonic
1146175122 17:30661180-30661202 CTGGCACCTGCTTGGCTTCTGGG + Intergenic
1146632897 17:34483575-34483597 CTGGAGCCTGCCAACTCTCTGGG + Intergenic
1148575049 17:48704576-48704598 CTGGATCCTGCCTCATTTCCTGG + Intergenic
1149242211 17:54663528-54663550 CTTAAGCCTGCCTAGTTCCTGGG - Intergenic
1151996317 17:77611517-77611539 CTGGGTCCTGCTGGGTTTCTGGG + Intergenic
1152094885 17:78267212-78267234 CTAGAGCCTGCCTGGTGTTGGGG + Intergenic
1152103321 17:78315214-78315236 CAGGACCCTGCCTGGCCTCTGGG - Intergenic
1152240918 17:79160540-79160562 CTGGAGCAGGCCTGGGTTCCCGG + Intronic
1152941909 17:83177235-83177257 CTGGAGCCGGGCTGGTGTCGAGG + Intergenic
1154012354 18:10586479-10586501 CATGAGCCTCCCTGGTTTCCAGG + Intergenic
1154083439 18:11279942-11279964 TTGGCATCTGCCTGGTTTCTAGG + Intergenic
1155862918 18:30926625-30926647 CTGGAGCCATCCTGGGTGCTAGG - Intergenic
1156477932 18:37417990-37418012 CTGGAACCTGCCTACTTTCCTGG + Intronic
1157104036 18:44756514-44756536 CTGGAGCCTGGCTTGTGGCTGGG - Intronic
1158514205 18:58117699-58117721 CTGCCCCCAGCCTGGTTTCTGGG + Intronic
1158514419 18:58119382-58119404 CTGCCCCCAGCCTGGTTTCTGGG + Intronic
1158529058 18:58241736-58241758 CTGGAACCTGTCTCTTTTCTTGG + Intronic
1159178857 18:64874809-64874831 GTGGATCTTGTCTGGTTTCTGGG - Intergenic
1159953091 18:74499349-74499371 CTGGAGCCTGTGTGGCCTCTTGG + Intronic
1160442701 18:78904385-78904407 CTGACTCCTGGCTGGTTTCTCGG - Intergenic
1160920950 19:1520326-1520348 CTGGTCCCTGCCTGGTCTCCTGG - Intergenic
1161200314 19:3010972-3010994 CTGGAGCAGGCCTCGTCTCTGGG - Intronic
1161231482 19:3177025-3177047 CTTGAACCTGCCTGGGGTCTAGG - Intronic
1161646206 19:5454941-5454963 CAGGATCCTGCCTGGTGTGTTGG + Intergenic
1161784003 19:6311940-6311962 CCTGAGCTTACCTGGTTTCTTGG - Intronic
1162461576 19:10817003-10817025 ATGGAGCCTGCTTTGTGTCTGGG - Intronic
1162495585 19:11021625-11021647 CTGGAGCCTTCCTGGCTGCTGGG + Intronic
1163283288 19:16330505-16330527 CTGCAGCCTGCCTGGGTGCTGGG - Intergenic
1163627467 19:18398340-18398362 CTGGAGTGAGCCTGGTGTCTGGG + Intergenic
1163846362 19:19640401-19640423 CTGGGGACTGCCTGGTAACTGGG + Intronic
1164882713 19:31748447-31748469 TGGGAGCCAACCTGGTTTCTTGG + Intergenic
1165422420 19:35728852-35728874 CTGGAGGCTGCCCTGATTCTGGG - Exonic
1167671907 19:50858406-50858428 CTGGACCCCACCTGGTTCCTTGG - Intronic
1168452449 19:56477104-56477126 CTCGCGCCTGCGTGGGTTCTCGG - Intronic
925356416 2:3244756-3244778 CTGGAAGCTACCTGGTTTATGGG + Intronic
925690177 2:6514380-6514402 CTGGCGTCTGCTTGGCTTCTGGG + Intergenic
925922191 2:8645473-8645495 CAGGAGCCCGCGTGGCTTCTCGG - Intergenic
926002971 2:9348953-9348975 CTGGAGCCAGCCTGACTTGTTGG + Intronic
926910615 2:17849432-17849454 CTGGATCCTGCTTTGCTTCTGGG - Intergenic
927107551 2:19841005-19841027 CTGGAGAAAGCCTGGGTTCTTGG + Intergenic
927674110 2:25091825-25091847 CTGGTGTCTGCCAGGTGTCTAGG + Intronic
928033625 2:27801718-27801740 CTGGCACCTGCGTGGTTTCTGGG + Intronic
929503783 2:42512315-42512337 CTGGAGCTTTCCTAGTTTTTCGG + Intronic
930600083 2:53432659-53432681 CTGGCATCTGCTTGGTTTCTGGG - Intergenic
931770239 2:65491087-65491109 CTAGAGCTGGCCTGGTTTCTGGG + Intergenic
932408023 2:71526878-71526900 CTGGAGACTGCAGGGTTTCCTGG - Intronic
932576434 2:72964853-72964875 CTGGGACCTGCCTAGTGTCTGGG - Intronic
933450826 2:82448378-82448400 CTGGAGTCTGCTTCGGTTCTTGG - Intergenic
936151972 2:110027007-110027029 CTGGTGCATGCCTGGGTGCTCGG + Intergenic
936192706 2:110344406-110344428 CTGGTGCATGCCTGGGTGCTCGG - Intergenic
936787039 2:116105963-116105985 CTGGTGTCTGGCTGGCTTCTTGG + Intergenic
942045102 2:172095424-172095446 CTGGAGGCTGTCTGCGTTCTTGG + Intergenic
942457607 2:176148768-176148790 CTTGAGCCAGCCTGGTGTATAGG - Intergenic
942803362 2:179901762-179901784 CTGGCATCTGCTTGGTTTCTAGG + Intergenic
944484660 2:200192427-200192449 CTGGAGACTGCCACATTTCTGGG + Intergenic
945072212 2:206003465-206003487 CTGCAGGCTGCCGGGGTTCTGGG - Exonic
945318936 2:208399333-208399355 CTGGCCCTTGGCTGGTTTCTGGG + Intronic
946713281 2:222527742-222527764 CTGTAGCCTGACTGGTACCTGGG - Intronic
947100847 2:226619832-226619854 CTGGAGGCTCCCTCTTTTCTAGG - Intergenic
947959182 2:234220605-234220627 TTGGGGCCTGGCTGGTCTCTTGG + Intergenic
948348674 2:237320768-237320790 CTGGGGTCTTCCTGCTTTCTTGG - Intergenic
948629732 2:239294404-239294426 CTGGAGCCTACCTGGCTCCCAGG + Intronic
948783866 2:240340824-240340846 CAGGAGCCTCTCTGGATTCTAGG - Intergenic
1169255029 20:4090769-4090791 TTGGTGCCTGCGTGATTTCTGGG - Intergenic
1169488663 20:6053707-6053729 CTGGAGCCTGGGTGGTGACTCGG - Intronic
1170387991 20:15841427-15841449 CTGGAATCTGCCTGGGTTCTGGG + Intronic
1170407133 20:16050200-16050222 CTGGCCCCTGTCTGCTTTCTTGG + Exonic
1170686086 20:18570744-18570766 GTTGAGCCTGCCTGGGCTCTTGG + Intronic
1171573753 20:26277917-26277939 CTGTATCCTGCCTGGGCTCTGGG + Intergenic
1171837065 20:30167312-30167334 CTGTATCCTGCCTGGGCTCTGGG - Intergenic
1172149132 20:32778477-32778499 CTGTAGCCTGCGTGGCTCCTGGG + Intronic
1172299400 20:33838644-33838666 CTGCAGCCTGGCTGGTGTCTAGG + Intronic
1173126625 20:40342297-40342319 CTGGGGCCAGCCTGGAGTCTGGG - Intergenic
1173148673 20:40547245-40547267 CTGGAGGCTGCATGGTTTTATGG - Intergenic
1174487410 20:50870228-50870250 CCTGACCCTGCCTGGTTTTTGGG - Intronic
1175092104 20:56513084-56513106 CTGGTGCCTGGATGGTGTCTGGG - Intronic
1175134500 20:56812869-56812891 CTGGCACCTGCTTGGCTTCTGGG + Intergenic
1175490099 20:59374317-59374339 CTGGAGCCTGCCTGGTAGTCTGG - Intergenic
1175762594 20:61571616-61571638 CTGGGGCTTGCCAGGCTTCTGGG - Intronic
1175900111 20:62356688-62356710 CTGGAGCCGGCCTGGGCCCTGGG - Intronic
1175985301 20:62761436-62761458 CTGGCGCCTCCTTGGTCTCTAGG + Exonic
1176158439 20:63635676-63635698 CTGGTGCTTGCTTGGTGTCTGGG - Intergenic
1177268211 21:18811067-18811089 CTGGCATCTGCCTGGCTTCTTGG + Intergenic
1177425715 21:20920951-20920973 CTGGGGCCTGTCTGGTGTCGGGG - Intergenic
1179791681 21:43759553-43759575 CTGCCGCCTGCCTGGTCTCATGG + Exonic
1180157484 21:45984562-45984584 CTGCAGCCTCCCTGTTCTCTTGG + Intronic
1180593800 22:16961107-16961129 CAGGGGCCTGGCTGGCTTCTGGG - Intergenic
1180929406 22:19578821-19578843 CAGGAGCATGCCTGGTCTCCTGG - Intergenic
1181021336 22:20104970-20104992 CTGGAGCCTGCCTGGCCCATGGG - Intronic
1181922274 22:26329557-26329579 CTGGAGCTGACATGGTTTCTTGG + Intronic
1182037825 22:27213386-27213408 CTGGTACCTGCCTGGTGTCCTGG + Intergenic
1182053630 22:27332099-27332121 CTCAAGCCTGCCTGGCTTCCTGG - Intergenic
1182759502 22:32710770-32710792 CTGGCATCTGCTTGGTTTCTCGG - Intronic
1184642785 22:45881054-45881076 CTGGAGCCAGCCGGGGTCCTGGG + Intergenic
1184768789 22:46586316-46586338 CTGGCGCCTCCCTGCTTTCCAGG + Intronic
1185055713 22:48577333-48577355 CTGGAAACTTCCTGGTTTCAGGG + Intronic
1185065667 22:48630695-48630717 CTGCAGCCTGTGTGGCTTCTAGG - Intronic
949703063 3:6781323-6781345 CTGGATACTCCCTGGTTGCTGGG - Intronic
950156510 3:10725126-10725148 CTGGAGCCTGCCTGCAGTCCAGG + Intergenic
951955904 3:28253153-28253175 CTGGAGTCTGCCTAGATTCCTGG + Intronic
952275829 3:31875656-31875678 CTAAAACCTGCCTGCTTTCTGGG - Intronic
952383483 3:32821839-32821861 CCGGAGCCTGCCTCGGCTCTGGG + Intronic
953703975 3:45217588-45217610 CAGGAGCCTGCCTGGTGGCTGGG - Intergenic
956724879 3:72148770-72148792 CTGGCATCTGCTTGGTTTCTGGG + Intergenic
958582910 3:96050468-96050490 CTGGCACCTGCTTGGCTTCTGGG + Intergenic
958989738 3:100828998-100829020 CTGGAGGCTGTCAGGCTTCTAGG - Intronic
960134015 3:114087696-114087718 CTGGCATCTGCTTGGTTTCTGGG + Exonic
960216457 3:115044077-115044099 CTGGAATCTGCTTGGTTTCTGGG - Intronic
961163311 3:124747714-124747736 CTGGATCCAGCCTGGTTACCAGG + Intergenic
961364385 3:126390044-126390066 CTGGAGCCCACTTGGTTTCCAGG - Intergenic
962172628 3:133118189-133118211 CTGTAGGTTGTCTGGTTTCTGGG + Intronic
962194899 3:133353044-133353066 TTGGTCTCTGCCTGGTTTCTTGG - Intronic
962381806 3:134904109-134904131 CTGGAGCCAGCCTCCTTTCCAGG - Intronic
963571206 3:146998590-146998612 CTGGAGCAAGCCTGGATTCTGGG + Intergenic
964809232 3:160644743-160644765 CTGGAATCTGCCTGTTTTTTGGG + Intergenic
965749281 3:171959611-171959633 CTGGAGCCTGGTTGGGTTTTGGG - Intergenic
966547113 3:181161804-181161826 CTGGCATCTGCCTGGCTTCTGGG + Intergenic
966626060 3:182018375-182018397 CTGTGGCCTGCTTGGTTCCTAGG + Intergenic
966916270 3:184585732-184585754 CTGGGGCCTGGATGGTTTCAAGG + Intronic
967997801 3:195179973-195179995 CTGGAGCCTGCCTGTGTTGGGGG - Intronic
968003876 3:195226077-195226099 CTAGAGTGTGTCTGGTTTCTAGG - Intronic
968328413 3:197842200-197842222 CTAGAGCCTAACTGGTTACTAGG - Intronic
968546197 4:1200269-1200291 GTGGAGCCTGCCTGGTCTCTGGG - Intronic
969669875 4:8583722-8583744 CTGGGGCCTCCCGGGTTCCTGGG - Intronic
970646160 4:18122685-18122707 CTGGCGTCTGCTTCGTTTCTGGG + Intergenic
970852388 4:20617104-20617126 GTGAAGCCTGCCTGGCTGCTGGG - Exonic
972346863 4:38199666-38199688 CTCCAGTCTGCCTGCTTTCTTGG + Intergenic
972423210 4:38909614-38909636 CTGGGGCATGCCTGGATTGTGGG - Intronic
973214871 4:47657631-47657653 CTAGAGTCTGCTTGGTTTCTAGG + Intronic
973643682 4:52928639-52928661 CTGAATCCTGCTTGGTGTCTTGG + Intronic
975208310 4:71669666-71669688 GTGAAGCCTGCTTGGCTTCTGGG + Intergenic
975261210 4:72301934-72301956 CTGTGGACTGCCTGGTGTCTTGG - Intronic
975839461 4:78458122-78458144 CTGGAGGCAGCCTGGACTCTAGG - Intronic
976105738 4:81615033-81615055 CAGGATCCTGCCTGATCTCTGGG - Intronic
977702946 4:100041026-100041048 AAGGAGGCTGCCTGATTTCTTGG + Intergenic
979487186 4:121283258-121283280 CTGGGGCCTGCCTGGCTTTGGGG - Intergenic
979607230 4:122651489-122651511 CTCCAGCGTGCCTGGTTTGTGGG - Intergenic
979724045 4:123939185-123939207 CTAGTGCCTCCCTGGTTACTGGG + Intergenic
979916894 4:126446302-126446324 CTGGAATCTGCCTGGCTTCTAGG - Intergenic
980547849 4:134292763-134292785 GTGGATCCTGCCTGGTGCCTGGG - Intergenic
984480814 4:180298949-180298971 CTGGCATCTGCTTGGTTTCTAGG - Intergenic
985321146 4:188712559-188712581 CTGGCACTTGCTTGGTTTCTGGG - Intergenic
986191437 5:5499761-5499783 CTGGAGCCTGCCTTTTTCCTGGG + Intergenic
987743616 5:21942175-21942197 CTTGAGGCTGCTTGGATTCTTGG - Intronic
987862494 5:23506172-23506194 CTGGCACCTGCTTGGCTTCTTGG - Intergenic
990675861 5:58183906-58183928 CTGGTCCCTGCCTGTTTTCCTGG - Intergenic
991763813 5:69952347-69952369 CTTGAGGCTGCTTGGATTCTTGG - Intergenic
991783512 5:70165792-70165814 CTTGAGGCTGCTTGGATTCTTGG + Intergenic
991843044 5:70827415-70827437 CTTGAGGCTGCTTGGATTCTTGG - Intergenic
991875957 5:71166122-71166144 CTTGAGGCTGCTTGGATTCTTGG + Intergenic
995476708 5:112555396-112555418 CTGGACTCAGCCTGGTCTCTCGG + Intergenic
995838515 5:116421715-116421737 CTGGCATCTGCTTGGTTTCTGGG + Intergenic
995878796 5:116821012-116821034 CTGGAATCTGCTTGGCTTCTGGG - Intergenic
996087454 5:119319640-119319662 CTGGAACCTCTCTGGTTTCTTGG + Intronic
996356222 5:122599201-122599223 ATGGAGCCTTACTGTTTTCTGGG + Intergenic
997276282 5:132594613-132594635 CAGAATTCTGCCTGGTTTCTGGG - Intronic
997392990 5:133532189-133532211 CTGGAGGCTACCTGCCTTCTTGG - Intronic
997435979 5:133875953-133875975 CTCTGGCCTGCCTGGGTTCTAGG + Intergenic
998942684 5:147301866-147301888 CTTGAGGCTGCCTGTATTCTCGG + Intronic
1000305006 5:159986999-159987021 CTGGAGCCATCCTGGGTTCTAGG - Intergenic
1000848340 5:166309373-166309395 CTGTGGCCTGGCTGATTTCTAGG - Intergenic
1001313533 5:170627520-170627542 CTGGAGCCTTGTTGTTTTCTTGG - Intronic
1001887551 5:175309136-175309158 TTAGAGTCTGACTGGTTTCTAGG - Intergenic
1002078987 5:176726703-176726725 CTGCATCCTGCCTGGGTGCTGGG - Intergenic
1002131247 5:177083022-177083044 CTGGAGCATGACGGCTTTCTGGG + Intergenic
1002271098 5:178072930-178072952 GTGGAGCCGGCCTGTTCTCTGGG - Intergenic
1003815737 6:9838157-9838179 CTGAGGCTTGCCTAGTTTCTAGG + Intronic
1004289388 6:14352446-14352468 ATGGAGGCAGCATGGTTTCTAGG + Intergenic
1006300248 6:33190298-33190320 GGGGAGCTTGCCTGGGTTCTGGG - Intronic
1007283108 6:40726716-40726738 CCGGAATCTGCTTGGTTTCTGGG - Intergenic
1007964884 6:45995100-45995122 AAGGGGCCTGCCTGGTATCTGGG - Intronic
1007992765 6:46274655-46274677 CTGGAGGCTGGCTGCTTTCCTGG - Intronic
1008742550 6:54627173-54627195 CTGGAAACTCCCTGGTTTCCAGG - Intergenic
1008944460 6:57082622-57082644 CTGAAGGCTGCCTAGTTTCCAGG - Intergenic
1010009891 6:71037595-71037617 CTGGTATCTGCCTGGCTTCTGGG + Intergenic
1010630619 6:78193065-78193087 CTGGCATCTGCTTGGTTTCTGGG + Intergenic
1010653699 6:78486211-78486233 CTGGAACATGCTTGGTTTCAAGG - Intergenic
1011858158 6:91721079-91721101 CGGCAGCCTGCCTGGTATCATGG + Intergenic
1012506345 6:99951034-99951056 CTGGAGCCCCACTGGTATCTTGG - Intronic
1014619779 6:123652429-123652451 CTAGTGTCTGCTTGGTTTCTGGG - Intergenic
1015411909 6:132903397-132903419 CTGAAGCCTGACTTATTTCTGGG - Intergenic
1016007972 6:139108558-139108580 CTGGAGCCTTCCTGTCTCCTTGG - Intergenic
1017031949 6:150231434-150231456 CTGGAGCCTTCATAGTTCCTGGG + Intronic
1018510661 6:164520953-164520975 CTGGCATCTGCTTGGTTTCTGGG - Intergenic
1018854051 6:167662920-167662942 CGTGAGCCAGCCTGGGTTCTGGG + Intergenic
1019200890 6:170314154-170314176 CTGGAGGCTGCCTTGTTCCTAGG - Intronic
1019455566 7:1125183-1125205 GTGGAGTGTGCCTGGTTGCTGGG - Intronic
1019542520 7:1557982-1558004 CTGGAGCCTGCCTGCTCCCCAGG + Intronic
1019931037 7:4223349-4223371 GTGGAGGCTGCCTAGTTTGTGGG - Intronic
1019936633 7:4262405-4262427 ATGGACCCTGCATGTTTTCTAGG - Intronic
1020122464 7:5512913-5512935 TAGGAGCTTGCCTGGGTTCTAGG - Intronic
1020244419 7:6419740-6419762 CTGGCCCCTGACGGGTTTCTGGG + Intronic
1020278915 7:6640334-6640356 CTGGCATCTGCCTGGCTTCTAGG + Intronic
1020809115 7:12829900-12829922 CTGGGACCTGCTTGGCTTCTGGG + Intergenic
1021268328 7:18553151-18553173 CTGGAGCCTTCCTGCTGACTTGG - Intronic
1022148196 7:27569483-27569505 CAGGAGCCAGCCTGATATCTGGG + Intronic
1022441003 7:30433303-30433325 TTGGAGCCTGGCTGTTTTCTGGG - Intronic
1022484200 7:30765486-30765508 CTGGAGCCTGGCTGGGGCCTGGG + Intronic
1024319734 7:48052864-48052886 CTGGAGCCTGGCTGCATCCTGGG - Exonic
1025284791 7:57652569-57652591 CTGTATCCTGCCTGGGCTCTGGG - Intergenic
1027236083 7:76298756-76298778 CTGGAGTCTGCCCCGATTCTGGG + Intergenic
1027643326 7:80765690-80765712 CTGCAGCCTCCCGGGTATCTGGG + Intronic
1029157954 7:98530634-98530656 CTGGCACCTGCTCGGTTTCTGGG - Intergenic
1032468494 7:132161689-132161711 CGGGAGCCTGCCAGGGTGCTAGG - Intronic
1033348028 7:140540528-140540550 GTGGACCCTGCCTGGATTCCTGG - Intronic
1034373834 7:150626607-150626629 AGGCAGCCTGCCTGGTTTATGGG - Exonic
1034431259 7:151042313-151042335 CTGCAGCCTGCCTGGTCTGCTGG - Intronic
1036621852 8:10429473-10429495 CTGGCATCTGCTTGGTTTCTGGG + Intergenic
1037100129 8:15033444-15033466 CTGCAGCCTGCCTGGACCCTGGG - Intronic
1037503156 8:19505127-19505149 CTGGAACCTGCCTGGGTGCCAGG + Intronic
1038948265 8:32385504-32385526 GTGGCGTCTGCTTGGTTTCTGGG + Intronic
1039743400 8:40402414-40402436 CTGGCACCTGCTTGGCTTCTGGG + Intergenic
1040079625 8:43274307-43274329 GTGGTCCCTGCCTGGTTTCCTGG + Intergenic
1040448528 8:47521152-47521174 CTGAACCCTTCCTTGTTTCTAGG + Intronic
1040652880 8:49469012-49469034 CTGGAGGCTGCCTGAATTCATGG - Intergenic
1042390808 8:68231388-68231410 CTTCTGCCTGCCTGGTTTCTTGG - Exonic
1043670432 8:82878489-82878511 TTGGAGCCTTACTGGTTTTTTGG - Intergenic
1043788911 8:84437880-84437902 CTGGCATCTGCTTGGTTTCTAGG - Intronic
1044873573 8:96643027-96643049 CTGGAGCCAGGCAGGTTGCTTGG + Intergenic
1046102977 8:109635749-109635771 CTGGAGTCTGCCTGCTTTGAAGG - Intronic
1047035068 8:120928641-120928663 CTGATGCCTGCCAGCTTTCTTGG - Intergenic
1047360998 8:124169338-124169360 CTGAATCCCGTCTGGTTTCTTGG + Intergenic
1047475444 8:125223950-125223972 CTGTAGCCTCCCTGGTAGCTGGG + Intronic
1047603304 8:126449350-126449372 TTGAAGTCTGCCTGGTTTATGGG - Intergenic
1047851873 8:128865781-128865803 CTGGCACCTGCTTGGATTCTAGG - Intergenic
1047874252 8:129117654-129117676 CTGTAGCCTGCATGGTACCTGGG - Intergenic
1049047433 8:140164115-140164137 CTGGAGCCGCCCTGGCTTGTGGG - Intronic
1049349400 8:142156149-142156171 CTGGAGCCTGCGGCGGTTCTGGG - Intergenic
1049430500 8:142560953-142560975 CTGCAGCCTCCCTAGTATCTGGG + Intergenic
1049436562 8:142588797-142588819 CTGGCATCTGCCTGATTTCTGGG - Intergenic
1049728636 8:144163965-144163987 CGGGAGCCTGAGTGGGTTCTGGG + Intronic
1050884523 9:10747133-10747155 CTAGAGCCTGCCAGAATTCTTGG - Intergenic
1051613097 9:18980627-18980649 CTGGGCCCTGCCTGCCTTCTGGG + Intronic
1051919649 9:22250416-22250438 CTGGCATCTGCTTGGTTTCTGGG + Intergenic
1052448623 9:28596896-28596918 CTGGAGCCTGGCTTGTTTACCGG - Intronic
1052999510 9:34569886-34569908 CTGGATCCATCCTGGCTTCTGGG - Intronic
1055191519 9:73530317-73530339 CTGGCCTCTGCCTGGCTTCTGGG - Intergenic
1055659833 9:78491737-78491759 CTGGTTTCTGTCTGGTTTCTGGG - Intergenic
1055794908 9:79965324-79965346 CTGAAGCCTCCCTTTTTTCTAGG + Intergenic
1056056090 9:82825688-82825710 CTGGCATCTGCTTGGTTTCTGGG + Intergenic
1056140252 9:83671116-83671138 GTGGAGCCTGCCAGGTGTGTTGG - Intronic
1056158089 9:83859645-83859667 CTTCAGCCTCCCTGGTTGCTGGG + Intronic
1056267896 9:84917803-84917825 CTGGCGCCTGACTGTTTTGTTGG - Intronic
1056352462 9:85764412-85764434 CTTCAGCCTCCCTGGTTGCTGGG - Intergenic
1056397430 9:86194469-86194491 CTGGAATCTGCTTGGCTTCTGGG - Intergenic
1056597245 9:88017770-88017792 TTGTAGCCTCCATGGTTTCTTGG + Intergenic
1056968401 9:91183156-91183178 TGGGAGCCTGGCTGGTTTGTTGG + Intergenic
1057397237 9:94691002-94691024 CTGGCTCCTGCCCTGTTTCTAGG + Intergenic
1060064560 9:120493126-120493148 CTAGAGCCTACCTGATTTCTTGG - Intronic
1061544852 9:131298740-131298762 CTGGCTCCTGCCTGGCCTCTGGG + Intronic
1061609061 9:131734167-131734189 TTAGAGCCTCCCTGGTTGCTGGG - Intronic
1061674983 9:132210607-132210629 CAGGAGCCTGCCGGGTGTCATGG - Intronic
1061757381 9:132824461-132824483 GAGGAACCTGCCTGGTTCCTGGG - Intronic
1061986105 9:134131254-134131276 CTGGTGCCTGCATGGCTTCTGGG + Intergenic
1186218320 X:7323826-7323848 CTAGAGCCTGCCTGCATTCCTGG + Intronic
1186514791 X:10158784-10158806 CTGGCCCCTGCCCGCTTTCTCGG - Intronic
1188533086 X:31163964-31163986 CTGGAGGCTGCCATCTTTCTTGG - Intronic
1189070291 X:37856435-37856457 CTGGGATCTGCTTGGTTTCTGGG + Intronic
1190126339 X:47708901-47708923 GTGGATCCTGCATGGTGTCTGGG + Intergenic
1192313868 X:70037077-70037099 CTGGGCTCAGCCTGGTTTCTGGG + Exonic
1193724293 X:85021235-85021257 CTGGGGCCAGCCTGGGTCCTGGG - Intronic
1193871713 X:86806202-86806224 CTGGCACCTGCTTGGCTTCTGGG + Intronic
1194854843 X:98915782-98915804 CTGGATTCAGCCTGTTTTCTAGG + Intergenic
1194916797 X:99717703-99717725 CTGGGGCCTGCCTGGTGCTTGGG - Intergenic
1196326153 X:114405670-114405692 TTGGAGTTTGACTGGTTTCTTGG - Intergenic
1196374937 X:115023326-115023348 CTGGAACCTGCCAGGTTTTGAGG + Intergenic
1198510041 X:137341233-137341255 CTGGTGACTGCTTGCTTTCTAGG + Intergenic
1198564394 X:137889441-137889463 CTTTAGCCAGCCAGGTTTCTTGG + Intergenic
1198828167 X:140720405-140720427 CTGGAGCTAGTCTGGTTTCTGGG - Intergenic
1200757337 Y:7002200-7002222 ATGGAGCTTGCCTGGTATTTGGG + Intronic
1202260335 Y:22963795-22963817 CTGGAGCGTGACATGTTTCTAGG + Intergenic
1202413322 Y:24597536-24597558 CTGGAGCGTGACATGTTTCTAGG + Intergenic
1202457460 Y:25072532-25072554 CTGGAGCGTGACATGTTTCTAGG - Intergenic