ID: 1141611339

View in Genome Browser
Species Human (GRCh38)
Location 16:85182707-85182729
Sequence GTGCAGGTCTTCAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141611332_1141611339 6 Left 1141611332 16:85182678-85182700 CCTGTCTTTAGGGTTTAAGACCT 0: 1
1: 0
2: 2
3: 9
4: 146
Right 1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG No data
1141611331_1141611339 11 Left 1141611331 16:85182673-85182695 CCAGGCCTGTCTTTAGGGTTTAA 0: 1
1: 0
2: 1
3: 41
4: 321
Right 1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141611339 Original CRISPR GTGCAGGTCTTCAGGGAGGC AGG Intronic
No off target data available for this crispr