ID: 1141612866

View in Genome Browser
Species Human (GRCh38)
Location 16:85192971-85192993
Sequence TAGGGCAGGAGGGCTGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141612854_1141612866 5 Left 1141612854 16:85192943-85192965 CCTGCGCCCAACCTGGCGTCTGG No data
Right 1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG No data
1141612857_1141612866 -2 Left 1141612857 16:85192950-85192972 CCAACCTGGCGTCTGGCCGACTA No data
Right 1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG No data
1141612856_1141612866 -1 Left 1141612856 16:85192949-85192971 CCCAACCTGGCGTCTGGCCGACT No data
Right 1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG No data
1141612860_1141612866 -6 Left 1141612860 16:85192954-85192976 CCTGGCGTCTGGCCGACTAGGGC No data
Right 1141612866 16:85192971-85192993 TAGGGCAGGAGGGCTGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141612866 Original CRISPR TAGGGCAGGAGGGCTGTTGG AGG Intergenic
No off target data available for this crispr