ID: 1141613142

View in Genome Browser
Species Human (GRCh38)
Location 16:85195070-85195092
Sequence CAGAGGTACATGCCTGCGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141613142_1141613143 -10 Left 1141613142 16:85195070-85195092 CCAATCGCAGGCATGTACCTCTG No data
Right 1141613143 16:85195083-85195105 TGTACCTCTGCCTACGTGTGAGG No data
1141613142_1141613150 6 Left 1141613142 16:85195070-85195092 CCAATCGCAGGCATGTACCTCTG No data
Right 1141613150 16:85195099-85195121 TGTGAGGGGAGAGGAGGAACAGG No data
1141613142_1141613145 -8 Left 1141613142 16:85195070-85195092 CCAATCGCAGGCATGTACCTCTG No data
Right 1141613145 16:85195085-85195107 TACCTCTGCCTACGTGTGAGGGG No data
1141613142_1141613144 -9 Left 1141613142 16:85195070-85195092 CCAATCGCAGGCATGTACCTCTG No data
Right 1141613144 16:85195084-85195106 GTACCTCTGCCTACGTGTGAGGG No data
1141613142_1141613147 -3 Left 1141613142 16:85195070-85195092 CCAATCGCAGGCATGTACCTCTG No data
Right 1141613147 16:85195090-85195112 CTGCCTACGTGTGAGGGGAGAGG No data
1141613142_1141613151 12 Left 1141613142 16:85195070-85195092 CCAATCGCAGGCATGTACCTCTG No data
Right 1141613151 16:85195105-85195127 GGGAGAGGAGGAACAGGCATAGG No data
1141613142_1141613149 0 Left 1141613142 16:85195070-85195092 CCAATCGCAGGCATGTACCTCTG No data
Right 1141613149 16:85195093-85195115 CCTACGTGTGAGGGGAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141613142 Original CRISPR CAGAGGTACATGCCTGCGAT TGG (reversed) Intergenic
No off target data available for this crispr