ID: 1141622696

View in Genome Browser
Species Human (GRCh38)
Location 16:85245403-85245425
Sequence CTGCGTTTCCACCTGGTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141622692_1141622696 25 Left 1141622692 16:85245355-85245377 CCGGGAGCATGGTGAAGGGAAGT No data
Right 1141622696 16:85245403-85245425 CTGCGTTTCCACCTGGTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141622696 Original CRISPR CTGCGTTTCCACCTGGTCCA GGG Intergenic
No off target data available for this crispr