ID: 1141623566

View in Genome Browser
Species Human (GRCh38)
Location 16:85249737-85249759
Sequence CGACTCCAAGCCAGGCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141623566_1141623574 9 Left 1141623566 16:85249737-85249759 CCTGAGGGCCTGGCTTGGAGTCG No data
Right 1141623574 16:85249769-85249791 CTCACAGCTGCGTGCCCAAGTGG No data
1141623566_1141623577 21 Left 1141623566 16:85249737-85249759 CCTGAGGGCCTGGCTTGGAGTCG No data
Right 1141623577 16:85249781-85249803 TGCCCAAGTGGCACAGGGTCAGG No data
1141623566_1141623575 15 Left 1141623566 16:85249737-85249759 CCTGAGGGCCTGGCTTGGAGTCG No data
Right 1141623575 16:85249775-85249797 GCTGCGTGCCCAAGTGGCACAGG No data
1141623566_1141623576 16 Left 1141623566 16:85249737-85249759 CCTGAGGGCCTGGCTTGGAGTCG No data
Right 1141623576 16:85249776-85249798 CTGCGTGCCCAAGTGGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141623566 Original CRISPR CGACTCCAAGCCAGGCCCTC AGG (reversed) Intergenic
No off target data available for this crispr