ID: 1141623573

View in Genome Browser
Species Human (GRCh38)
Location 16:85249768-85249790
Sequence CACTTGGGCACGCAGCTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141623573_1141623577 -10 Left 1141623573 16:85249768-85249790 CCTCACAGCTGCGTGCCCAAGTG No data
Right 1141623577 16:85249781-85249803 TGCCCAAGTGGCACAGGGTCAGG No data
1141623573_1141623584 14 Left 1141623573 16:85249768-85249790 CCTCACAGCTGCGTGCCCAAGTG No data
Right 1141623584 16:85249805-85249827 CGCCCTGCAGTTTGGCAGGTGGG No data
1141623573_1141623581 10 Left 1141623573 16:85249768-85249790 CCTCACAGCTGCGTGCCCAAGTG No data
Right 1141623581 16:85249801-85249823 AGGCCGCCCTGCAGTTTGGCAGG No data
1141623573_1141623588 19 Left 1141623573 16:85249768-85249790 CCTCACAGCTGCGTGCCCAAGTG No data
Right 1141623588 16:85249810-85249832 TGCAGTTTGGCAGGTGGGCAGGG No data
1141623573_1141623583 13 Left 1141623573 16:85249768-85249790 CCTCACAGCTGCGTGCCCAAGTG No data
Right 1141623583 16:85249804-85249826 CCGCCCTGCAGTTTGGCAGGTGG No data
1141623573_1141623580 6 Left 1141623573 16:85249768-85249790 CCTCACAGCTGCGTGCCCAAGTG No data
Right 1141623580 16:85249797-85249819 GGTCAGGCCGCCCTGCAGTTTGG No data
1141623573_1141623587 18 Left 1141623573 16:85249768-85249790 CCTCACAGCTGCGTGCCCAAGTG No data
Right 1141623587 16:85249809-85249831 CTGCAGTTTGGCAGGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141623573 Original CRISPR CACTTGGGCACGCAGCTGTG AGG (reversed) Intergenic