ID: 1141623575

View in Genome Browser
Species Human (GRCh38)
Location 16:85249775-85249797
Sequence GCTGCGTGCCCAAGTGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141623570_1141623575 7 Left 1141623570 16:85249745-85249767 CCTGGCTTGGAGTCGGGGCTGCC No data
Right 1141623575 16:85249775-85249797 GCTGCGTGCCCAAGTGGCACAGG No data
1141623565_1141623575 16 Left 1141623565 16:85249736-85249758 CCCTGAGGGCCTGGCTTGGAGTC No data
Right 1141623575 16:85249775-85249797 GCTGCGTGCCCAAGTGGCACAGG No data
1141623566_1141623575 15 Left 1141623566 16:85249737-85249759 CCTGAGGGCCTGGCTTGGAGTCG No data
Right 1141623575 16:85249775-85249797 GCTGCGTGCCCAAGTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141623575 Original CRISPR GCTGCGTGCCCAAGTGGCAC AGG Intergenic
No off target data available for this crispr