ID: 1141623577

View in Genome Browser
Species Human (GRCh38)
Location 16:85249781-85249803
Sequence TGCCCAAGTGGCACAGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141623565_1141623577 22 Left 1141623565 16:85249736-85249758 CCCTGAGGGCCTGGCTTGGAGTC No data
Right 1141623577 16:85249781-85249803 TGCCCAAGTGGCACAGGGTCAGG No data
1141623571_1141623577 -8 Left 1141623571 16:85249766-85249788 CCCCTCACAGCTGCGTGCCCAAG No data
Right 1141623577 16:85249781-85249803 TGCCCAAGTGGCACAGGGTCAGG No data
1141623572_1141623577 -9 Left 1141623572 16:85249767-85249789 CCCTCACAGCTGCGTGCCCAAGT No data
Right 1141623577 16:85249781-85249803 TGCCCAAGTGGCACAGGGTCAGG No data
1141623566_1141623577 21 Left 1141623566 16:85249737-85249759 CCTGAGGGCCTGGCTTGGAGTCG No data
Right 1141623577 16:85249781-85249803 TGCCCAAGTGGCACAGGGTCAGG No data
1141623573_1141623577 -10 Left 1141623573 16:85249768-85249790 CCTCACAGCTGCGTGCCCAAGTG No data
Right 1141623577 16:85249781-85249803 TGCCCAAGTGGCACAGGGTCAGG No data
1141623570_1141623577 13 Left 1141623570 16:85249745-85249767 CCTGGCTTGGAGTCGGGGCTGCC No data
Right 1141623577 16:85249781-85249803 TGCCCAAGTGGCACAGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141623577 Original CRISPR TGCCCAAGTGGCACAGGGTC AGG Intergenic
No off target data available for this crispr